Labshake search
Citations for Takara Bio :
1 - 50 of 2391 citations for PCR Tubes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and its contents were expelled into a PCR tube containing the lysis buffer (Takara, 634894). Metadata for all Patch-seq neurons including in this study are located in Supplementary Data Table 3.
-
bioRxiv - Neuroscience 2020Quote: ... The contents of the pipette were expelled into a PCR tube containing lysis buffer (Takara, 634894). cDNA libraries were produced using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... cytosol and/or nucleus content in each pipette were expelled into individual PCR tubes containing 11.5 µl of lysis buffer (Takara, 634984) and stored in −80 °C.
-
bioRxiv - Neuroscience 2023Quote: ... we harvested 10-12 GFP+ cells per fly into 0.5ul nuclease free water in the pipette tip and then the tip was broken into a 96 well PCR tube containing RNAse inhibitors and buffer as described by Clontech’s ultra low HV SMARTer Ultra Low RNAseq kit (Catalog #634823) ...
-
bioRxiv - Neuroscience 2020Quote: ... cytosol and nucleus was removed from pipette holder and contents were expelled into a PCR tube containing the lysis buffer (Takara, 634894).
-
bioRxiv - Neuroscience 2020Quote: ... and nucleus was removed from the pipette holder and contents were expelled into a PCR tube containing lysis buffer (Takara, 634894).
-
bioRxiv - Neuroscience 2020Quote: ... The pipette was removed from the recording chamber and the contents of the pipette were expelled into a PCR tube containing lysis buffer (Takara, 634894). Patch-seq sample tubes were held on dry ice in a benchtop plexiglass enclosure throughout the recording session to ensure collected samples remained free of RNAse and DNAse contamination ...
-
bioRxiv - Neuroscience 2020Quote: ... cytosol and nucleus was removed from pipette holder and contents were expelled into a PCR tube containing the lysis buffer (Takara, 634894).
-
bioRxiv - Neuroscience 2022Quote: ... and nucleus was removed from the pipette holder and contents were expelled into a PCR tube containing lysis buffer (Takara, 634894).
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Fresh tubes of RRI (Cat. 2313B TaKaRa) were used in all comparisons in this study.
-
bioRxiv - Developmental Biology 2020Quote: ... were transferred into 0.2-mL PCR tubes and processed for sequencing using Seq® v4 Ultra® Low Input RNA Kit (Takara Bio USA, Mountain View, CA) as described in Wood et al ...
-
bioRxiv - Immunology 2021Quote: ... using the 1.5mL centrifuge tube magnetic stand (Takara, #621964). The final library concentrations and qualities were determined by both SYBR PCR (Kapa Biosystems ...
-
bioRxiv - Genomics 2020Quote: Round 1 PCR amplicons were collected from the ICELL8 chip using the SMARTer ICELL8 Collection Kit: (Collection Fixture, Collection Tube and Collection Film) into a collection and storage tube as per manufacturer’s instructions (Takara Bio USA, CA, USA). 50% of the extracted library was purified twice using a 1X proportion of AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... recombined by PCR (TaKaRa PCR kit (Clontech Laboratories)) using the primers and cycle conditions in Table S1C ...
-
bioRxiv - Microbiology 2021Quote: ... recombined by PCR (TaKaRa PCR kit (Clontech Laboratories)) using the primers and cycle conditions in Table S1C ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR (CloneAmp HiFi PCR Premix, Takara-Bio Europe) genotyping was done with primers designed for each knock-out line that allowed for confirming either the presence of the wild-type (F-gt5/R-gt5WT and F-gt3WT/R-gt3 ...
-
bioRxiv - Plant Biology 2023Quote: ... we PCR amplified (CloneAMP HIFI PCR premix, TAKARA) the coding sequences of ATG8a ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was done using the Terra™ PCR Direct PCR mix (Takara Bio, Kusatsu, Shiga Japan). Genotyping for Lhx2 was performed as described earlier (Mangale et al. ...
-
bioRxiv - Cancer Biology 2023Quote: For indexing PCR, 78μL PCR mix (24μL H20, 50μL 2X SeqAmp CB PCR buffer (Takara Cat. #638526), 2μL SeqAmp DNA polymerase ((Takara Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using SaphireAmp Fast PCR Master Mix (Takara) in 50 μl volume.
-
bioRxiv - Biochemistry 2023Quote: ... All PCR was done with HiFi PCR master mix (Takara) following the manufacturer recommendations.
-
bioRxiv - Microbiology 2022Quote: All plasmid inserts were amplified by PCR using standard PCR conditions and the CloneAmp HiFi PCR premix (Takara). Following a PCR purification step (QIAquick PCR purification kit) ...
-
bioRxiv - Cell Biology 2020Quote: ... nested PCR was performed using PCR Mycoplasma Detection Set (Takara, 6601).
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were performed using CloneAmp™ HiFi PCR Premix (Takara) for 35 cycles with an annealing temperature of 52 °C according to the manufacturer’s suggestions ...
-
bioRxiv - Immunology 2021Quote: ... with the Power PCR TB green PCR master mix (Takara, Japan). 2µl of sample cDNA was used in a total volume of 10µl (3µl primer mix and 5µl of TB green ...
-
bioRxiv - Microbiology 2019Quote: PCR were performed using the Terra PCR Direct Polymerase Mix (Clontech) directly on the cell lysates using the following primers:
-
bioRxiv - Microbiology 2019Quote: PCR were performed using the Terra PCR Direct Polymerase Mix (Clontech) directly on the cell lysates after each round of co-infection ...
-
bioRxiv - Biochemistry 2019Quote: ... The PCR products were extracted with PCR purification kits (Takara 9761) and ligated using a Blunting Kination Ligation Kit (Takara 6217) ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was PCR-amplified using Terra PCR Direct Polymerase (Takara Bio). Final libraries were prepared using 1ng of cDNA per library with the Nextera XT kit (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... The PCR was done in PrimeStar GXL PCR reaction (TaKaRa, R050A). The primer sequences are:
-
bioRxiv - Immunology 2023Quote: ... PCR was performed on a PCR thermal cycler (Takara, Tokyo, Japan) and real-time PCR was performed using QuantStudio 3 (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... All PCR reactions were performed using the PCR components from Takara bio Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... Each PCR reaction was composed of CloneAmp HiFi PCR premix (Takara), 4ng of the plasmid template and 10-20ng of the primer pair mix ...
-
bioRxiv - Microbiology 2024Quote: ... PCR DNA amplifications were performed with CloneAmp HiFi PCR premix (Takara) using Primer-AP (5’ GACCACGCGTATCGATGTCGAC 3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/μl) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/ml) ...
-
bioRxiv - Immunology 2021Quote: ... directly into 1.7 ml eppendorf tubes containing 12.0 μl 1X reaction buffer (Takara) for cDNA synthesis using the SMART-Seq v4 Ultra low Input RNA kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... tubes with 1:1 FBS:PBS supplemented with recombinant RNase inhibitor (1:100, Takara). The live singlet gated CD3+ T cells were further gated as per the gating strategy shown in additional file 1 ...
-
bioRxiv - Molecular Biology 2020Quote: Primary RT-PCR and secondary PCR was performed using the Primescript III 1-step RT-PCR kit and EmeraldAmp GT PCR Mix (Takara; detailed protocol provided in Supplementary File 1) ...
-
bioRxiv - Microbiology 2020Quote: ... All elements of the DiCre plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated (In-Fusion HD Cloning Kit, Clontech) into an acceptor plasmid containing a TgDHFR/TS cassette flanked by two LoxP sites ...
-
bioRxiv - Immunology 2023Quote: ... The components of the master mix for the PCR and the PCR programs were set up according to the CloneAmp HIFI PCR protocol (Takara). All generated plasmids were sequenced before use (Eurofins Genomics).
-
bioRxiv - Plant Biology 2024Quote: ... The qRT-PCR analysis was performed using the ABI StepOne Plus PCR system and the SYBR Green Realtime PCR mix (Takara). The ubiquitin gene (Lj5g3v2060710 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System using SYBR Green PCR Master Mix (TaKaRa). Primer pairs used were listed in Supplementary (Table S2) ...
-
bioRxiv - Neuroscience 2021Quote: ... Real time PCR was done via Real-time PCR equipment TP970 (Takara) and analyzed by Thermal Cycler Dice® Real Time System (Takara).
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Cell Biology 2021Quote: ... open reading frames were PCR-amplified using CloneAmp HiFi PCR Premix (Clontech), gel-purified using the Nucleospin® Gel and PCR Clean-Up kit (Macherey-Nagel) ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCR was performed with EmeraldAmp MAX PCR Master Mix (Takara). Primers for amlplication of Piezo1 and Gapdh genes were listed in our previous study [26].