Labshake search
Citations for Takara Bio :
1 - 50 of 65 citations for Non Ab Component of Alzheimer's Disease Amyloid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... All PCR reactions were performed using the PCR components from Takara bio Inc ...
-
bioRxiv - Bioengineering 2022Quote: SMARTer Stranded Total RNAseq Kit v2 - Pico Input Mammalian Components (Takara, Cat No 634419)
-
bioRxiv - Cancer Biology 2023Quote: ... non-adherent plate (Takara Bio). Cells were grown for 14 days ...
-
bioRxiv - Cell Biology 2019Quote: ... cloned in pRACE vector as per kit instructions and transformed into Stellar component cells (Clontech, 636763). The inserts were verified by Sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... Ab anti-GFP (Clontech #632592, WB dilution 1:1000), Ab Beta Actin HRP conjugated (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human iPSC line ChiPSC22 (Cellartis/Takara Bio Europe AB) was cultivated in the feeder-free DEF-CS system (Cellartis/Takara Bio Europe ...
-
bioRxiv - Microbiology 2024Quote: ... pLPCX(AB) is a version of pLPCX (Clontech Laboratories) in which the EcoRI-ClaI region of the multi-cloning site was removed and replaced by a duplex created by annealing oligodeoxynucleotides Linker-EcoBamNotCla-s (5’-AATTCACGGATCCTTGCGGCCGCAT ...
-
bioRxiv - Systems Biology 2021Quote: ... Other plasmid components (see Supplementary Table 1) were synthesized or PCR amplified with PrimerSTAR MAX DNA polymerase (TAKARA) and checked by Sanger sequencing ...
-
bioRxiv - Genomics 2023Quote: All libraries were prepared using the SMARTer Stranded Total RNaseq Kit v2 – Pico Input Mammalian Components (634419, Takara) according to manufacturer’s protocols and barcoded (634452 ...
-
bioRxiv - Cell Biology 2020Quote: Yeast COPII components were cloned from the Saccharomyces cerevisiae S288c genome into appropriate expression vectors using In-Fusion (Takara), specifically ...
-
bioRxiv - Neuroscience 2021Quote: ... Stem123 (AB-123-U-050, 1:1000 dilution; Takara Bio Inc.), TBR1 (ab183032 ...
-
bioRxiv - Neuroscience 2021Quote: ... Stem121 (AB-121-U-050, 1:1000 dilution; Takara Bio Inc.), Stem123 (AB-123-U-050 ...
-
A Plant-Specific Polarity Module Establishes Cell Fate Asymmetry in the Arabidopsis Stomatal LineagebioRxiv - Plant Biology 2019Quote: ... Directed yeast two-hybrid constructs were generated by ligation of cDNAs into vector components of the Matchmaker II system (Clontech). Bait and prey clones were cotransformed into yeast strain AH109 ...
-
bioRxiv - Microbiology 2019Quote: ... The IL-1β and components of RISC mRNA expression levels of the NA cells were quantified with the SYBR Green qPCR kit (Takara) by following the manufacturer’s instruction using gene-specific primers (S2 Table) ...
-
bioRxiv - Genetics 2020Quote: ... Microglial RNA was isolated using the TRIzol method and cDNA libraries were generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing Components (Takara) according to the manufacturer’s protocol.The libraries were sequenced as 150 bp paired-end reads with an average read depth of 42 million (range 16-98M ...
-
bioRxiv - Microbiology 2023Quote: The component concentration of each reaction mix included 10μL of 2X EmeraldAmp® GT PCR master mix (Takara Bio, Japan), 1μL (0.5μM ...
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...
-
bioRxiv - Immunology 2021Quote: Amplicons comprising the 5’intron of exon 3 of Sp140 and the end of exon 3 were amplified from crude DNA from ear clips of B6 and Sp140-/- 1 mice (sense: TCATATAACCCATAAATCCATCATGACA; antisense: CCATTTAGGAAGAAGTGTTTTAGAGTCT) with PrimeStar PCR components (Takara, R010b) for 18 cycles according to manufacturer specifications ...
-
bioRxiv - Cell Biology 2023Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Neuroscience 2021Quote: ... Stem101 (AB-101-U-050, 1:200 dilution; Takara Bio, Inc., Shiga, Japan), Stem121 (AB-121-U-050 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-Stem 123 (1:200 Y40420; Cellartis, Takara Bio Europe AB, Gothenburg, Sweden), anti-NF-H (1:200 Aves NFH7857983) ...
-
bioRxiv - Cell Biology 2023Quote: ... containing a single-vector Tet-on component and were cultured in the presence of 1 µg/ml doxycycline (Clontech, Mountain View, CA, USA) during induction.
-
bioRxiv - Neuroscience 2023Quote: ... guinea pig polyclonal anti-RAX (1:200; M229 Takara Bio Europe Ab, Goteborg, Sweden); rabbit polyclonal anti-activated caspase 3 (AC3 ...
-
bioRxiv - Immunology 2022Quote: ... non-tissue culture treated 24-well plates were coated with RetroNectin (TaKaRa) overnight at 30 mg/mL ...
-
bioRxiv - Biochemistry 2020Quote: ... non-tissue culture treated 48 well plates were coated with RetroNectin (Clontech) according to the manufacturer’s recommendations overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... Reactions involving non-AAV plasmids were transformed into Stellar competent cells (Takara Inc.) and those involving AAV plasmids were transformed into NEB Stable competent cells (New England Biolabs).
-
bioRxiv - Synthetic Biology 2023Quote: ... 12-well non-TC treated plates were coated with retronectin (Takara Bio T100B) at a concentration of 32ng/ml in PBS ...
-
bioRxiv - Immunology 2019Quote: ... non-tissue cultured treated 24 well plates were coated with 50μg/mL Retronectin (Takara) overnight and washed once with 1mL/well PBS ...
-
bioRxiv - Immunology 2019Quote: ... non-tissue culture treated 24-well plates were coated with 50 μg/mL Retronectin (Takara) overnight at 4 °C and washed once with PBS ...
-
bioRxiv - Plant Biology 2020Quote: The 5’ Digoxigenin labeled R-box and non-labeled oligonucleotides were synthesized (Takara, Dalian, China). The binding mixture contained nuclear extracts ...
-
bioRxiv - Immunology 2023Quote: ... the non-tissue culture 24-well plates were coated with 7 μg/ml RetroNectin (TAKARA) for 3 hours at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Virus was plated on non-tissue culture treated 24-well plates precoated with retronectin (TaKaRa) overnight at 4°C ...
-
bioRxiv - Immunology 2019Quote: Non-tissue culture treated 12-well plates were coated overnight at 4C with 1mL Retronectin (Takara) at 25ug/mL in PBS ...
-
bioRxiv - Genetics 2021Quote: ... prepare non-tissue culture treated plates by adding RetroNectin (1 μg/μL; Takara Bio, Otsu, Japan) to enhance transduction efficiency ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Microbiology 2023Quote: ... USA) or non-targeting control siRNA with TransIT-X2 Dynamic Delivery System (V6100, Takara Bio Inc.) in Opti-MEM ...
-
bioRxiv - Immunology 2021Quote: ... 24-well non-tissue culture plate wells were pre-coated with RetroNectin® (Takara Bio USA, Inc.) according to manufacturer’s instructions and then day 10 cultured Tregs were added at 0.3 x 106 cells/well in 0.3mL of cell culture media ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Immunology 2023Quote: ... Transduction was performed on non-tissue culture 24-well plates previously coated with 0.5mL of RetroNectin (Takara) at a concentration of 25 μg/mL in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated overnight at 4°C with primary antibody diluted in blocking buffer (these were: 1:200 Living Colors Ab, #632380, Takara; 1:100 L-plastin ...
-
bioRxiv - Bioengineering 2021Quote: ... non-tissue culture treated 24 well plates were coated with Retronectin according to the manufacturer’s instructions (Takara/Clontech). On day 3 post-isolation ...
-
bioRxiv - Bioengineering 2021Quote: ... non-tissue culture treated 24 well plates were coated with Retronectin according to the manufacturer’s instructions (Takara/Clontech). On day 3 post-isolation ...
-
bioRxiv - Bioengineering 2020Quote: ... concentrated lentivirus was added to non-TC treated 6-well plates which were coated with retronectin (Takara #T100B) according to manufacturer’s instructions and spun at 1200 x g for 90 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant (5 ml) was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and incubated for 4 h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... primary antibody was prepared in PBS containing 1% non-fat milk using anti-hexahistidine antibody (Takara Bio, catalog #631212) at a dilution of 1:3000 ...
-
bioRxiv - Genomics 2021Quote: ... Non-tissue culture treated 12-well plates were prepared by incubating 1 mL PBS + 25 μg/mL Retronectin (Takara) overnight at 4°C ...