Labshake search
Citations for Takara Bio :
1 - 50 of 1098 citations for Nipah Virus Glycoprotein G Recombinant Protein Human Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Immunology 2019Quote: ... and Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2023Quote: ... Retroviruses with the vesicular stomatitis virus–G (VSV-G) envelope were produced by transfection of GP2-293 cells (Clontech) with the pRetroX construct and pVSV-G (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... RetroNectin® Recombinant Human Fibronectin Fragment (Takara Bio, Cat#T100A), Recombinant Murine Flt3-Ligand (Peprotech ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... recombinant protein (vector pColdTM TF-DNA, Takara Clontech) to use as the antigen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... recombinant protein (vector pColdTM TF-DNA, Takara Clontech) to use as the antigen ...
-
bioRxiv - Microbiology 2023Quote: The plasmid constructs used as repair template for recombinant virus generation were generated using InFusion cloning (TaKaRa). The sequence references below are based on the HSV-1 KOS genome accession number JQ673480 (Macdonald et al 2012) ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Synthetic Biology 2022Quote: Pantropic vesicular stomatitis virus G pseudotyped lentivirus was produced via transfection of LentiX 293T cells (Clontech #11131D) with a pHR’SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using FuGENE HD (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Purification tags were removed by treating recombinant proteins with HRV3C protease (TaKaRa) and cOmplete™ His-tag Purification Resin (Roche) ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... virus-containing media was harvested for virus isolation using Lenti-X concentrator (Takara) in lieu of ultracentrifugation ...
-
bioRxiv - Immunology 2022Quote: ... Retroviral vectors were packaged into VSV G–pseudotyped murine leukemia virus (MLV) particles by co-transfecting GP2-293 cells (Clontech Laboratories) with pQCXIP constructs and pVSV-G (Clontech Laboratories) ...
-
bioRxiv - Cancer Biology 2023Quote: Production of vesicular stomatitis virus (VSV-G) pseudotyped lentivirus was performed by calcium phosphate transfection of Lenti-XTM 293T cells (TaKaRa Clontech, 632180) with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260) ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Cancer Biology 2023Quote: Production of vesicular stomatitis virus (VSV-G) pseudotyped lentivirus was performed by calcium phosphate transfection of Lenti-XTM 293T cells (TaKaRa Clontech, 632180) with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260) ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant protein was purified using the His60 Ni gravity column purification kit (Takara Bio) according to the manual instruction ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant proteins of interest were bound to TALON metal affinity beads (Clontech, Mountain View, CA) and eluted with imidazole (gradient 10–200 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified from Escherichia coli BL21 (DE3) with TALON Metal Affinity Resin (Takara), Pierce Glutathione Agarose (Thermo scientific) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The recombinant Irg1-like protein was enriched using cobalt TALON Metal Affinity Resin (Takara Bio #635501) with gentle shaking for 1 hour at 4 ℃ and washed twice by centrifugation for 3 minutes at 3500 rpm at 4 ℃ and resuspension in the washing buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant protein was produced in Escherichia coli BL21 (DE3) and purified with TALON resin (Clontech). For immunization ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... Virus containing supernatant was collected and virus particles were concentrated by Lenti-X concentrator (Clontech Laboratories, CA) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Biochemistry 2021Quote: ... After 12 h medium was collected and recombinant proteins were purified on TALON metal affinity resin (Takara). 200 μl of the resin was loaded onto 1 ml column (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant RNase inhibitor (Takara) and protease inhibitor cocktail (Sigma-Aldrich)) ...
-
bioRxiv - Systems Biology 2023Quote: ... Recombinant DNase I (TaKaRa) was used to digest DNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Biophysics 2022Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and resuspended in DPBS before being applied to neurons.
-
bioRxiv - Cell Biology 2022Quote: ... The virus titer (ifu/ml) defined by Clontech’s Lenti-X qRT-PCR Titration Kit (Cat ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... Virus was precipitated using Lenti X-concentrator (Takara) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and titer quantified using p24 ELISA antigen assay (Takara) ...
-
bioRxiv - Microbiology 2020Quote: ... lysed by sonication and the recombinant His-tagged protein purified from cell-free extracts using IMAC (Talon resin, Clontech) as previously described19.
-
bioRxiv - Microbiology 2019Quote: ... The Pfc43opt recombinant protein was soluble and purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant protein in the soluble fraction was then purified using TALON Metal Affinity Resin (Clontech Laboratories, CA, USA) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... 1.85U recombinant RNase Inhibitor (Takara), 1.85 μM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
bioRxiv - Plant Biology 2019Quote: 6His-GST-CRK2cyto and 6His-MBP-RBOHD/C constructs for recombinant proteins were generated by using In-Fusion technology (Clontech). The coding regions of CRK2cyto (WT ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilised metal affinity chromatography (IMAC using Talon resin; Clontech) as described previously (34) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The recombinant proteins were purified using a TALON Metal (Cobalt) Affinity Resin column (Clontech Laboratories, Inc., Palo Alto, CA, USA) and eluted with a linear gradient of imidazole (0–1,000 mM ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech). Lentivirus titers from 48h and 72h were determined by plaque assay (data not shown ...