Labshake search
Citations for Takara Bio :
1 - 50 of 379 citations for Myelin Basic Protein Biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... The fragment was first cloned into the pLacZ-Basic vector (Clontech, Japan) at KpnI/Xho sites ...
-
bioRxiv - Plant Biology 2020Quote: The 5’ Digoxigenin labeled R-box and non-labeled oligonucleotides were synthesized (Takara, Dalian, China). The binding mixture contained nuclear extracts ...
-
bioRxiv - Developmental Biology 2023Quote: ... and labeled with dsRED (Clontech 632496) and a anti-rabbit alexafluor 647 secondary antibody ...
-
bioRxiv - Plant Biology 2023Quote: ... and end-labeled by T4 polynucleotide kinase (Takara Bio) and [γ-32P]-ATP (PerkinElmer) ...
-
bioRxiv - Physiology 2020Quote: ... Amplified fragments were subcloned into the MluI and EcoRI sites of the pSEAP2-Basic reporter plasmid (Clontech, Mountain View, CA) and sequenced to confirm correct orientation (Eurofins Genomics ...
-
bioRxiv - Genomics 2019Quote: ... Human Universal Reference Total RNA (Takara Bio/Clontech, labeled A), a mixture of 23 normal human tissues (including brain ...
-
bioRxiv - Genomics 2019Quote: ... Human Universal Reference Total RNA (Takara Bio/Clontech, labeled A), a mixture of 23 normal human tissues (including brain ...
-
bioRxiv - Molecular Biology 2019Quote: ... and fluorescent double-labeled probes were synthesized by Takara (Japan). All of the DNA and RNA sequences are provided in Table S1 ...
-
bioRxiv - Developmental Biology 2021Quote: The MLP:H2B-Turquoise sequence (originally from BRE-MLP-H2B-Turquoise pGL3 basic, Briscoe lab, unpublished) was cloned using In-Fusion Cloning (Takara, 639650) between two chicken insulators at the BamHI site of plasmid pJC5-4 (Chung et al. ...
-
bioRxiv - Microbiology 2023Quote: ... TwistAmp® Basic Kit (TwistDx, TABAS03KIT), Milenia HybriDtect1 (TwistDX, Milenia01), UltraPure DNase/RNase-Free Distilled Water (Thermo, 10977015) and RNase inhibitor (Takara, 2313A). Thermo Fisher Nanodrop 1000 Spectrophotom was used to quantify nucleic acid ...
-
bioRxiv - Biochemistry 2022Quote: ... probes labeled with [α-32P] dCTP by random priming (Takara, cat# 6045) were hybridized to the membrane in PerfectHyb Plus Hybridization buffer (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Genetics 2022Quote: ... ISH was performed using digoxigenin-labeled oligonucleotide lnc-WAL probe (TCAGCACTGTCATCATTACATT) (Takara, Japan) according to previous literature(Liu et al. ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using BCA Protein Assay Kit (TaKaRa). The samples were subjected to SDS-PAGE ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-labeled PACSIN2 was prepared by subcloning PACSIN2 cDNA into pmCherry-C1 vector (Clontech), in which the GFP in pEGFP-C1 was replaced with mCherry ...
-
bioRxiv - Neuroscience 2019Quote: ... or IMPA1L 120nt fragment were labeled using Random Priming Labeling Kits (Takara or Roche) and [α−32P] dCTP ...
-
bioRxiv - Immunology 2023Quote: ... Probes (50 ng) were labeled with 32P using the Ladderman DNA labeling kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... 32P-labeled dsRNAs were synthesized using the in vitro T7 Transcription kit (Takara Bio) with [α-32P]-UTP (PerkinElmer ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were probed with γ32P 5’ end-labeled oligonucleotide (Table S3) in ExpressHyb solution (Clontech) and scanned after exposition with Typhoon FLA 9500 scanner (GE Healthcare).
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Developmental Biology 2020Quote: ... dissected calvaria from 9SL or 11SL fish were labeled with antibodies against mCherry (Takara, 1/100), GFP (Roche ...
-
Constitutive and conditional epitope-tagging of endogenous G protein coupled receptors in DrosophilabioRxiv - Neuroscience 2023Quote: Myristoylated TdTomato (myr::TdTom) was labeled with 1:500 rabbit anti-DsRed (Takara Cat# 632496, RRID:AB_10013483)
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... we first produced lentivirus with Pup(E) plasmid Biotin-Pup(E)-IRES-BFP within the Tet-On 3G inducible expression system (Clontech 631168), and infected Jurkat cells for 48 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... An oligonucleotide probe against snoRNA58 labeled with [γ-32P] ATP by T4 polynucleotide kinase (Takara, cat# 2021A) was used as a loading control ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were tagged with Gfp (enhanced green fluorescent protein; Clontech, Mountain View, CA, USA) at their N-terminus unless noted otherwise ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein purity and concentration were determined by SDS-PAGE and BCA protein assay kit (Takara) respectively ...
-
bioRxiv - Biophysics 2019Quote: ... cDNAs encoding cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) were purchased from Clontech Com ...
-
bioRxiv - Cell Biology 2022Quote: ... Total protein was quantified using the TAKARA BCA Protein Assay Kit (TAKARA Bio Inc., Japan). Equal amounts of protein were separated by SDS-PAGE on 10% gels ...
-
bioRxiv - Immunology 2021Quote: ... and the protein concentration was measured by BCA protein assay kit (TaKaRa, Dalian, China, cat#T9300A) as previous described(Ma et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein concentration was found to be 0.9 µg/µl using BCA Protein Assay Kit (TaKaRa).
-
bioRxiv - Microbiology 2022Quote: Protein-protein interactions were assayed with the Matchmaker yeast two-hybrid system (Clontech, Mountain View, CA). ORFs of AoHse was amplified from first-strand cDNA of A ...
-
bioRxiv - Physiology 2022Quote: ... Obtained luminescence was normalized to total protein concentration measured by BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...
-
bioRxiv - Neuroscience 2020Quote: Enhanced green fluorescent protein (EGFP, Clontech), Tag-blue fluorescent protein (Tag-BFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... protein was estimated using BCA (TaKaRa), and 100 µg protein was incubated with 20 µl packed protein G-sepharose beads (Sigma P3296 ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio) in accordance with the manufacturer’s protocol ...