Labshake search
Citations for Takara Bio :
1 - 50 of 5878 citations for Mouse Sulfotransferase family cytosolic 2B member 1 SULT2B1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Con 1B and Con 2B were purchased from Takara Bio Inc (ChiPSC-6b ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Cell Biology 2022Quote: ... Cytosolic GFP (pEGFP-N1) and mCherry (pmCherry-N1) vectors were purchased from Clontech. H2B-mCherry was a gift from Robert Benezra (Addgene plasmid #20972 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Cell Biology 2021Quote: ... The construct for cytosolic expression of RpHLuorin2 was generated by replacing EGFP in pEGFP-N1 (Clontech) with synthesized RpHLuorin2 using restriction sites AgeI and BsrGI ...
-
bioRxiv - Biophysics 2020Quote: ... control cells were infected with lentivirus encoding cytosolic mCherry in a pLVX-Puro vector backbone (Clontech) (Wu et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Clontech, 1:5000) rat anti-RFP (Chromotek ...
-
bioRxiv - Molecular Biology 2023Quote: ... His6 (631212, Clontech, mouse, 1:500); NPL4 (sc-365796 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Clontech,1:6,000), mouse anti-FLAG (Millipore-Sigma ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Genomics 2020Quote: ... All lentiviral particles other than those used in the RAW cell transductions and Figure 2B (top panel) were further purified and concentrated with the Lenti-X Concentrator reagent (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mCherry 1:500 (632543, Clontech); chicken anti-Gfp 1:500 (ab13970 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:1000; Clontech #632460), rabbit anti-somatostatin (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry for mCherry (mouse, 1:1000, Takara; goat anti-mouse-alexa594 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse-anti-mCherry (Clontech, 632543 1:1000). Secondary antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:200; Clontech #632381) overnight at 4⁰C ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-Cherry (1:500; Clontech, 632543), Rabbit anti-Gat (1:4,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-STEM121 (Takara, Y40410, 1:250), goat anti-ChAT (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP (mouse, Clontech cat# 632380; 1:2,000); FLAG (mouse ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-mCherry (632543, Clontech; 1:500), mouse anti-GFP (ab1218 ...
-
bioRxiv - Genetics 2021Quote: 1:500 mouse anti-GFP (Takara, JL-8)
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP monoclonal JL8 (1:3000, Clontech), and mouse anti-α-tubulin monoclonal DM1A (1:3000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse GFP (1:4,000, Living Colors, 632380, Clontech) and rabbit β-Actin (1:3,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% normal donkey serum ...
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse anti-GFP (1:200; PA; Clontech). Alexa Fluor 488- ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Anti-GFP (1:1000; JL-8, Clontech). Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and mouse anti-SPARC/Osteonectin (ON1-1, Takara) for 1 h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and titer quantified using p24 ELISA antigen assay (Takara). MOI=5 was used to transduce 1x1097 EndoC-βH3 cells in culture media without pen/strep and puromycin.
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with α-MYC (mouse, 1:500, Clontech #631206) in 4 % BSA-PBS for 60 min at room temperature to stain surface expressed GluK2 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies against mCherry (Mouse, Clontech, 632543; 1/500), GFP (rabbit polyclonal anti-GFP ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse monoclonal anti-GFP (Clontech; milk; 1:2,000).
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-DSRed (targeting mCherry; 1:2000; Clontech), washed ...