Labshake search
Citations for Takara Bio :
1 - 50 of 1747 citations for Mouse Cationic Amino Acid Transporter 1 CAT1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... two to three amino acids in GFP-SP-BAP were replaced by alanine for each construct using the CloneAmp HiFi PCR Premix (Takara Bio) according to the manufacturer.
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Immunology 2023Quote: ... The expression vectors for the S variants with multiple amino acid changes or deletions were generated using the In-Fusion HD cloning kit (Takara Bio). The pcDNA3.1-hACE2 used to express human ACE2 (hACE2 ...
-
bioRxiv - Biophysics 2019Quote: ... D40A mutation and deletion of C-terminal 10 amino acids were introduced into pET15-sfGFP-minD by using the PrimeSTAR Max mutagenesis protocol (TaKaRa, Shiga, Japan). Similarly ...
-
bioRxiv - Biophysics 2019Quote: ... The pCD86-EGFP had been created by inserting CD86 with a 21 amino acid linker coding region on its C-terminus immediately before EGFP in pEGFP-N1 (Clontech/Takara, Mountain View, CA). The CD86-21aa was amplified from pCD86-mEos2 (Mike Heilemann via Addgene ...
-
bioRxiv - Cell Biology 2019Quote: Amino acid substitutions in RNF167 were made using site-directed mutagenesis by Prime Star GXL-DNA polymerase (R050A, Takara Bio Inc., Otsu, Japan) according to the manufacturer’s protocol with the following primers:
-
bioRxiv - Biophysics 2019Quote: ... The pCD86-EGFP had been created by inserting CD86 with a 21 amino acid linker coding region on its C-terminus immediately before EGFP in pEGFP-N1 (Clontech/Takara, Mountain View, CA). The CD86-21aa was amplified from pCD86-mEos2 (Mike Heilemann via Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... target proteins were purified from cell lysate by Ni-iminodiacetic acid affinity chromatography (Clontech). However ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentration was determined by bicinchoninic acid assay using bovine serum albumin (TaKaRa Bio) as the reference standard ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Clontech, 1:5000) rat anti-RFP (Chromotek ...
-
bioRxiv - Molecular Biology 2023Quote: ... His6 (631212, Clontech, mouse, 1:500); NPL4 (sc-365796 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Clontech,1:6,000), mouse anti-FLAG (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2022Quote: Every protein expressed in mouse rods was also cloned into pEGFP-N1 (Clontech) for expression in AD293 cells using the AgeI and NotI cloning sites within the vector to replace EGFP with the tagged proteins ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mCherry 1:500 (632543, Clontech); chicken anti-Gfp 1:500 (ab13970 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:1000; Clontech #632460), rabbit anti-somatostatin (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry for mCherry (mouse, 1:1000, Takara; goat anti-mouse-alexa594 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse-anti-mCherry (Clontech, 632543 1:1000). Secondary antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:200; Clontech #632381) overnight at 4⁰C ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-Cherry (1:500; Clontech, 632543), Rabbit anti-Gat (1:4,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-STEM121 (Takara, Y40410, 1:250), goat anti-ChAT (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-mCherry (632543, Clontech; 1:500), mouse anti-GFP (ab1218 ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP (mouse, Clontech cat# 632380; 1:2,000); FLAG (mouse ...