Labshake search
Citations for Takara Bio :
1 - 50 of 908 citations for Mouse Anti Nipah Virus Glycoprotein F CG11 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Cancer Biology 2023Quote: ... virus-containing media was harvested for virus isolation using Lenti-X concentrator (Takara) in lieu of ultracentrifugation ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Neuroscience 2021Quote: ... pDsRed monomer-F (Clontech), or iRFP670 (kindly gifted from Prof ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti dsRed (Clontech) 1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-mCherry (Takara Bio ...
-
bioRxiv - Synthetic Biology 2022Quote: ... mouse anti-TetR (Clontech; 9G9 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-dsred (Takara), rabbit anti-GFP (Proteintech) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Virus containing supernatant was collected and virus particles were concentrated by Lenti-X concentrator (Clontech Laboratories, CA) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-His6 (Clontech, 631212). Anti-Flag beads were purchased from SIGMA.
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-mCherry (Clontech, 632543) 1:200 ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-GFP (Clontech, 632381), 1:10,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry (Clontech, 632543) at 1:450 ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Biophysics 2022Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and resuspended in DPBS before being applied to neurons.
-
bioRxiv - Cell Biology 2022Quote: ... The virus titer (ifu/ml) defined by Clontech’s Lenti-X qRT-PCR Titration Kit (Cat ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... Virus was precipitated using Lenti X-concentrator (Takara) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and titer quantified using p24 ELISA antigen assay (Takara) ...
-
bioRxiv - Physiology 2020Quote: ... N-glycosidase F (PNGase, Takara, 4450) was used as previously reported [22] ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse JL8 anti-GFP (Clontech, 632381); mouse P124 anti-desmoglein 1 (Progen ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Clontech, 1:5000) rat anti-RFP (Chromotek ...
-
bioRxiv - Pathology 2022Quote: ... Rat anti Mouse OCN (Takara, M188); Rabbit anti Mouse MGST1 (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP monoclonal JL8 (Clontech), mouse anti-myc (Cell Signaling Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... We used mouse anti-GFP (Takara) at 1:1000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Clontech,1:6,000), mouse anti-FLAG (Millipore-Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of total RNAs were reverse-transcribed into cDNA at 42°C for 1 h in 20 μl reaction mixture containing mouse Moloney leukemia virus reverse transcriptase (PrimeScript, TAKARA BIO, Shiga, Japan) with random 6 primers (TAKARA BIO) ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech). Lentivirus titers from 48h and 72h were determined by plaque assay (data not shown ...
-
bioRxiv - Immunology 2019Quote: ... and virus was concentrated using Lenti-X Concentrator (Takara). Existing mIRAK1mCherry and Irak1−/− iBMDM were then transduced with concentrated lentivirus ...
-
bioRxiv - Genomics 2021Quote: ... and virus was collected with LentiX Concentrator (Takara, # 631232). HUVEC were infected with combinations of two viruses and used 96 h after infection ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech), and suspended in PBS.
-
bioRxiv - Microbiology 2019Quote: ... Virus packaging was assessed using Lenti-X GoStix (Clontech) but virus titers were not otherwise measured ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus was extracted using Lenti-X concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus was extracted using Lenti-X concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Virus was concentrated using LentiX concentrator (Takara, Shiga, Japan).
-
bioRxiv - Immunology 2023Quote: ... the virus was concentrated using RetroX concentrator reagent (Takara). Meanwhile ...
-
bioRxiv - Cancer Biology 2023Quote: ... Virus was concentrated with Lenti-XTM Concentrator from Takara and re-suspended in NeuroCultTM NS-A Complete Media.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mCherry 1:500 (632543, Clontech); chicken anti-Gfp 1:500 (ab13970 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:1000; Clontech #632460), rabbit anti-somatostatin (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti GFP (#632381, Takara Bio Clontech), mouse anti Vinculin (#V9131-100UL ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti GFP (#632381, Takara Bio Clontech), mouse anti Vinculin (#V9131-100UL ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse-anti-mCherry (Clontech, 632543 1:1000). Secondary antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:200; Clontech #632381) overnight at 4⁰C ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-Cherry (1:500; Clontech, 632543), Rabbit anti-Gat (1:4,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Clone JL-8; Clontech) at 1:1,000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-STEM121 (Takara, Y40410, 1:250), goat anti-ChAT (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-mCherry (632543, Clontech; 1:500), mouse anti-GFP (ab1218 ...
-
bioRxiv - Bioengineering 2022Quote: ... Virus-containing supernatants were concentrated with Retro-X concentrator (Takara). PBMCs were stimulated for 2 days with CD3/CD28 T cell activation beads (Thermo # 11131D ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was extracted using Lenti-X™ concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was extracted using Lenti-X™ concentrator (Clontech Takara) according to the manufacturer’s instructions ...