Labshake search
Citations for Takara Bio :
1 - 50 of 869 citations for Mouse Anti Cytomegalovirus Glycoprotein B Antibody 0811 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the human cytomegalovirus (hCMV) promoter/immediate-early enhancer (IE) of peGFP-N1 (Clontech) and the chimeric intron (chI ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% normal donkey serum ...
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Biophysics 2024Quote: ... and blotted with anti-GFP/YFP antibody (mouse, Clontech) at 1:5000 dilution overnight at 4° C on a rocking platform ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were mouse anti-STEM121 (1:500; Takara), chicken anti-GFAP (1:2,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... a mouse anti-mCherry primary antibody (Takara Bio, 1:5000) was used instead of the substance P primary antibody to visualize hM3Dq-mCherry or mCherry-expressing cells.
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech (632381). Monoclonal mouse anti-Flag (M2 ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with primary antibodies: mouse anti-GFP (1:2000; Clontech), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary anti-6xHis monoclonal mouse antibody (Clontech, 631212, diluted 1:1,000) was used to detect 6xHis-ubiquitin in samples permeabilized with 0.5% Triton-X100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Living colors mouse anti-GFP monoclonal antibody was purchased from Clontech, and goat anti-mouse antibody HRP-conjugated antibody was purchased from Jackson ImmunoResearch.
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-mCherry monoclonal antibody (1:500; Takara Bio Cat# 632543), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Plant Biology 2023Quote: ... Anti-GFP (monoclonal antibody raised in mouse, Takara, USA, catalog # 632381) and anti-SEC12 (Bar-Peled and Raikhel ...
-
bioRxiv - Bioengineering 2022Quote: ... gene segments of HA7 and NA9 ectodomains were cloned downstream of the cytomegalovirus promoter in pTriEx3 expression vector (Clontech). The vectors were transfected into A549 cells in 96-well microtiter plate using TransLT transfection reagent (Mirus ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Sections were incubated overnight with mouse anti-STEM121 primary antibody (Takara, Y40410) and then developed with a DAB substrate kit (Cell Signaling ...
-
bioRxiv - Immunology 2022Quote: ... The SMARTer Mouse TCR a/b Profiling Kit (Takara, Cat. No. 634403) was used to amplify both TCRα and TCRβ sequences ...
-
bioRxiv - Biochemistry 2020Quote: ... Each PCR product was subcloned into the NheI and XhoI sites of a cytomegalovirus promoter-driven pIRES2-AcGFP1 vector (Clontech Laboratories Inc. ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in primary antibody (1:1,000 mouse anti-calbindin, Sigma; 1:500 rabbit anti-DsRed, Clontech; 1:1,000 guinea pig anti-vGluT1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following primary antibodies were used: mouse anti-Nc82 (Laissue et al., 1999) rabbit anti-DsRed (TaKaRa Bio ...
-
bioRxiv - Developmental Biology 2021Quote: ... AP20187 (B/B) compound (Takara Bioscience) was injected into the dorsal aorta through a small window made in the ventral egg ...
-
bioRxiv - Biophysics 2022Quote: ... B/B homodimeriser (AP20187, Takara Bio), dibenzocyclooctyne-PEG4-maleimide (760676 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Cell Biology 2019Quote: ... Antibodies used for this study were: mouse anti-GFP JL-8 (Clontech, 1:3000), rabbit anti-PfEF1α (from D ...
-
bioRxiv - Cell Biology 2022Quote: ... The following primary antibodies were used: 1:2000 mouse anti-GFP (RRID:AB_2313808, 632381, Clontech); 1:2000 mouse anti-3V5 (RRID:AB_2556564 ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP fusion proteins were revealed with mouse monoclonal antibody anti-GFP (JL-8, Clontech) used at 1/2000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: mouse anti-GFP JL-8 (1:1000; TaKaRa), mouse anti-Tubulin AA4.3-c (1:5000 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibody was used in this study: mouse anti-GFP (JL8, Takara). Goat anti-mouse (A32730 ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated with primary antibody (anti-Th [mouse] 1:1500, Immunostar; anti-dsRed [rabbit] 1:1500, Clontech) overnight at RT shaking ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... B/B dimerizer (AP20187 ligand; TaKaRa 635058) was added to a final concentration of 500 nM in the well ...
-
bioRxiv - Immunology 2022Quote: ... B/B homodimerizer (Takara Bio, Cat#635058), b-estradiol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 nM B/B Homodimerizer (Takara, #635058) was also added ...
-
bioRxiv - Neuroscience 2023Quote: B/B homodimerizer was purchased from Takara USA lnc ...
-
bioRxiv - Microbiology 2023Quote: ... and subsequently stained using a horseradish peroxidase (HRP)-conjugated monoclonal anti-StrepTag antibody (Iba) or mouse anti-6His (Clontech) monoclonal antibody combined with rabbit anti-mouse-HRP polyclonal antibodies (DAKO) ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were subjected to 4-20% SDS-PAGE and analyzed by immunoblotting with the following primary antibodies: anti-GFP mouse monoclonal antibody (JL-8, Takara), GFP rabbit polyclonal antibody (PABG1 ...
-
bioRxiv - Molecular Biology 2021Quote: The following antibodies were used for western blotting: mouse anti-GFP (1:5000; Clontech 632381), rabbit anti-Vinculin (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were probed with commercial mouse monoclonal antibodies: anti-GFP (Clontech Living Colors JL-8), anti-mCherry (Abcam 1C51 ...
-
bioRxiv - Pathology 2020Quote: AP21087 ((B/B homodimerizer, Takara Bio, CA, USA) was administered by intra-peritoneal (ip ...
-
bioRxiv - Cell Biology 2019Quote: ... AP20187 (B/B Homodimerizer) was purchased from Takara. The recombinant Anti-M1 Spastin rabbit monoclonal antibody ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti dsRed (Clontech) 1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-mCherry (Takara Bio ...
-
bioRxiv - Synthetic Biology 2022Quote: ... mouse anti-TetR (Clontech; 9G9 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-dsred (Takara), rabbit anti-GFP (Proteintech) ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 500 nM of the B/B dimerizer (TaKaRa 635058) was added 2 hours before the start of the assay (or an Ethanol vehicle control was added) ...
-
bioRxiv - Immunology 2019Quote: ... B/B Homodimerizer (Takara, 635059, equivalent to AP-20187), disuccinimidyl suberate (DSS ...
-
bioRxiv - Neuroscience 2022Quote: ... AP20187 (B/B) (Clontech, Saint-Germain-en-Laye France) was added 4 h post-transfection overnight.
-
bioRxiv - Developmental Biology 2022Quote: Primary antibodies and concentrations used: mouse anti-GFP Living Colors (JL-8) (Takara Biosciences; cat# 632381) 1:500 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunoblotting was performed using an anti-GFP mouse monoclonal antibody (JL8; 1:1000; TaKaRa Bio Inc.) and an anti-ubiquitin mouse monoclonal antibody (P4D1 ...