Labshake search
Citations for Takara Bio :
1 - 50 of 514 citations for MERS Coronavirus Spike Glycoprotein S1 His tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Cell Biology 2022Quote: ... Fimbrin Fim1 was expressed in Escherichia coli and purified via His-tag affinity to Talon Metal Affinity Resin (Clontech, Mountain View, CA) (Skau & Kovar ...
-
bioRxiv - Molecular Biology 2022Quote: ... downstream of the His tag with In-Fusion HD (TaKaRa). The Gly172Phe substitution was induced by site-directed mutagenesis.
-
bioRxiv - Molecular Biology 2022Quote: ... downstream of the His tag with In-Fusion HD (TaKaRa). The His154Gly substitution was induced by site-directed mutagenesis.
-
bioRxiv - Biochemistry 2023Quote: ... Cleavage of the His-tag by HRV3C protease (Takara, 7360) followed the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatant was incubated with TALON His-tag purification resin (TaKaRa) or glutathione agarose beads (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Microbiology 2023Quote: ... templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara), cloned into pET22b ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a permanent C-terminal His-tag were purified using TALON (Clontech) resin followed by anion exchange using a Hitrap Q column (Cytiva) ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Biophysics 2023Quote: WT and R203M N175-245were purified using the TALON His-tag purification protocol (Clontech Laboratories). Cell pellets were lysed in high salt buffer (50 mM tris ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed to insert these linear fragments into the pMV306 previously digested with EcoRV and transformed into Escherichia coli (E. coli) Stellar TM competent cells (Takara Bio), purified (NucleoSpin Plasmid ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were harvested and purified using TALON His-Tag Purification protocol (Clontech Laboratories, Mountain View, CA.) The SUMO tag was cleaved by Ulp-1 as described above and the protein was further purified using ion-exchange chromatography (Bio-Rad ...
-
bioRxiv - Systems Biology 2023Quote: ... Ligated plasmid products were transformed into stellar competent cells (E. coli HST08 strain, Takara Bio). See Table S1 for full descriptions of constructs.
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA3.4 expression vector containing the sequence that encodes the His-tagged extracellular domain of the spike protein was transfected into Expi293 cells and the His-tagged spike protein produced in the culture supernatants was then purified with a Talon resin (Clontech).
-
bioRxiv - Systems Biology 2023Quote: ... was used as the wild-type (WT) strain for genetic manipulations. Chemically competent Escherichia coli (E. coli) DH5α and HST08 (Stellar Competent Cells, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) were used as the host strains for molecular cloning.
-
bioRxiv - Biophysics 2021Quote: ... Constructs containing both His and Strep tags were purified using gravity flow columns containing His60 Ni-NTA resin (Clontech) followed by Streptactin affinity chromatography (IBA Lifesciences ...
-
bioRxiv - Biophysics 2021Quote: ... A cDNA coding for 128QHTT with C-terminal fusion to a FLAG-His affinity tag was cloned into the vector pTRE-tight-BI-AcGFP1 (Clontech) for expression of 128QHTT upon induction with Dox ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cell debris was removed upon centrifugation and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 10 mM imidazole and then eluted with lysis buffer containing 250 mM imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... The cell debris was removed upon centrifugation in a SS34 rotor at 4 °C (27,000 × g for 15 min) and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 25 mM imidazole and then eluted with lysis buffer containing 500 mM imidazole ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing CDS of each Hero protein and C-terminal FLAG and His tags was inserted into pCold I (Takara) by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR product was purified and ligated into the pET15b vector with a C-terminal His tag to create plasmid pET-AdpA by using the ClonExpress™ II One Step Cloning Kit (TaKaRa). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: ... an MBP-tag and a TEV protease recognition site (His-MBP-TEV) by Infusion® HD Cloning kit (Takara Bio, USA). The fidelity of the constructs was confirmed by gel electrophoresis and sequencing.
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Cell Biology 2022Quote: ... were run onto 8% SDS- polyacrylamide gels that were transferred to nitrocellulose membranes which were reacted with α-His tag antibody (#631212, Clontech). Quantitation of band intensities was done with ImageLab software (BioRad) ...
-
bioRxiv - Plant Biology 2021Quote: ... Recombinant proteins were induced by 1 mM IPTG at 16°C for 20 h, then purified by a GST-tag Protein Purification Kit (Beyotime, Shanghai, China) or His TALON Purification Kit (Takara, Beijing, China). Corresponding primers are listed in Supplemental Table S2.
-
bioRxiv - Immunology 2024Quote: ... genes encoding the variable regions of C7 and C74 heavy chains were cloned into a pMN vector with a human CH1 domain and a C-terminal His-tag using In-Fusion cloning system (Takara Bio #639649). The full light chains of C7 and C74 were cloned into the pMN vector without any purification tag using the same method ...
-
bioRxiv - Molecular Biology 2023Quote: ... His (Clontech), supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT ...
-
bioRxiv - Microbiology 2020Quote: ... digested spike backbone vectors (Takara).
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630428, Clontech) or –Trp ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630419, Clontech) selective media +3 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (Clontech) with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... coli HST08 (used to test coregulation of genes in newly-formed operons and for vector construction; E. coli HST08 Premium Competent Cells, Takara Bio, Japan, 9128).
-
bioRxiv - Microbiology 2020Quote: ... coli (Clontech), extracted and retransformed into EAW19 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Six hundred thirty nanograms of total RNA was annealed to random 9-mer primers (TaKaRa) and reverse-transcribed using ProtoScript II (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-His (Clontech 631212), anti-H3K36me2 (Upstate 07-369) ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged mCherry (mCherry-His) was PCR amplified from pmCherry-C1 vector (Takara) templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Takara) and selected on LB-Ampicillin plates ...
-
bioRxiv - Biochemistry 2020Quote: ... coli cells (TaKaRa) were transformed with these plasmids for amplification and DNA storage ...
-
bioRxiv - Microbiology 2021Quote: ... coli DH5α (Takara) or Stellar™ (Takara ...
-
bioRxiv - Cell Biology 2022Quote: ... coli (Clontech 636763) via heat shock ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... coli (Takara,#9027) were transformed using electroporation and the subcloned library was obtained by combining 4 maxipreps ...
-
bioRxiv - Microbiology 2021Quote: ... coli DH5α (Takara) and Stellar™ (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar (Takara) and E ...
-
bioRxiv - Cell Biology 2022Quote: ... coli (Takara Bio). Plasmids were purified by miniprep (Qiagen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli Stellar (Takara) cells on LB- or M9 minimal-agar supplemented with 1 mM IPTG were inoculated into 250 μL of the same liquid medium and grown in a 1.5-mL 96-deep well plate at 240 rpm for ~10 generations ...