Labshake search
Citations for Takara Bio :
1 - 50 of 249 citations for MERS Coronavirus Spike Glycoprotein S1 Camel Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Molecular Biology 2021Quote: TET-ON stable HEK293 cells with the Tetracycline-inducible expression constructs were grown in DMEM supplemented with 10% TET-approved FCS (Clontech) and induction of expression of respective gene product was carried out for indicated time durations using 400 ng/ml Doxycycline (SIGMA) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HEK293 cells (Takara 632180), C3H/10T1/2 Clone 8 (ATCC# CCL-226) ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 Tet-off cells (Clontech) were transfected with pTRE-TIGHT plasmids bearing the (de)optimized and WT sequences and incubated overnight at 37ºC ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293 Tet-ON cells (Clontech) were co-transfected with linearized pTRE-HTT128Q together with a plasmid expressing a hygromycin resistance gene ...
-
bioRxiv - Microbiology 2020Quote: ... digested spike backbone vectors (Takara).
-
bioRxiv - Cell Biology 2020Quote: ... 7.5 × 107 Hek293-lentiX cells (Clontech) were seeded on 15-cm tissue culture plates ...
-
bioRxiv - Cancer Biology 2019Quote: HEK293 Lenti-X (Clontech, Cat. # 632180) cells were cultured in DMEM with 10% FBS ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 (Clontech #C3003-1; lot #7030396) cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293S Lenti-X producer cells (Takara/Clontech) were transfected in DMEM with 2 % (v/v ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293S Lenti-X producer cells (Takara/Clontech) were transfected in DMEM with 2 % (v/v ...
-
bioRxiv - Bioengineering 2023Quote: HEK293 cells (DMSZ) and HEK293T cells (Takara) were maintained in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Six hundred thirty nanograms of total RNA was annealed to random 9-mer primers (TaKaRa) and reverse-transcribed using ProtoScript II (New England Biolabs) ...
-
bioRxiv - Immunology 2019Quote: ... HEK293 cells were transfected using Xfect (TakaRa, #631318) with the viral packaging construct [pMDLg/pRRE (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2022Quote: ... Lenti-X HEK293 cells (Takara Bio, Cat #632180) were transfected with pHR-SFFV-dCas9-BFP-KRAB ...
-
bioRxiv - Microbiology 2022Quote: ... genomic DNA was digested with S1 nuclease (TaKaRa, Kusatsu, Japan) at 37°C for 20 minutes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the amplified DNA samples were processed with S1 nuclease (TaKaRa) to reduce branching junctions.
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was incubated with 1 μL of S1 nuclease (Takara, Okasa, Japan) for 4 h at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA samples were digested with SacI and S1 nuclease (Takara Bio, #2410) and analyzed by agarose gel electrophoresis followed by staining with SYBR Gold nucleic acid gel stain (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... the Sma I site of pT7-pOV8 was changed to Bgl II site with ten mer Bgl II linker (GCAGATCTCG, TAKARA) to produce pT7-Bgl II-pOV8 ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-GFP-tag (Living Colors 632592; Clontech), anti-Strep-tag (34850 ...
-
bioRxiv - Cancer Biology 2019Quote: ... embryonic kidney cell line HEK293(ATCC CRL-1573) and 293GP cells (Clontech) were cultured in high glucose (5g/l ...
-
bioRxiv - Immunology 2023Quote: ... CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were co-transfected either with pEGFP-N1 (Clontech, 6085-1) or pCAG-DsRed-T1 (gift from Prof ...
-
bioRxiv - Biochemistry 2019Quote: ... RT was performed using Oligo(dT) random 6-mer primers from a Prime Script RT Master Mix kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... the relevant oligonucleotides (Table S1) were ligated into the pmCherry-C1 vector (Clontech).
-
bioRxiv - Physiology 2021Quote: ... and quantitative primers (Perfect Real Time Primer, Takara, Shiga, Japan, Supplemental Table S1). The expression was normalized to GAPDH within each sample.
-
Phylogeny-metabolism dual-directed single-cell genomics for dissecting and mining ecosystem functionbioRxiv - Microbiology 2023Quote: ... the 16S rRNA targeted oligonucleotide probes GAM42a (Table S1, TAKARA Bio Inc., Japan) was applied to the identification of γ-Proteobacteria ...
-
Phylogeny-metabolism dual-directed single-cell genomics for dissecting and mining ecosystem functionbioRxiv - Microbiology 2023Quote: ... Negative controls were performed by probe NONEUB (Table S1, TAKARA Bio Inc., Japan).
-
bioRxiv - Microbiology 2019Quote: Full length Sarm1 with a C-terminal V5 tag or the V5 tag alone was cloned into the pLVX-IRES-Puro lentiviral vector (Clontech) and transfected into 293T cells along with gag/pol and VSV-G expression plasmids to generate lentiviral particles ...
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Microbiology 2021Quote: Expression plasmids encoding for human ZMPSTE24 with and without a C-terminal FLAG-tag or HA-tag were PCR amplified and subcloned into the pQXCIP (Clontech) backbone using flanking restriction sites AgeI and BamHI ...
-
bioRxiv - Genetics 2023Quote: ... the sequences corresponding to Flag tags were replaced by those encoding for Myc tags using the In-Fusion PCR cloning system (Takara) according to the kit’s guidelines ...
-
bioRxiv - Biochemistry 2023Quote: The full-length SKP1-FBXO22 fusion protein with a 3xGGGS-linker was cloned into a pNic-Bio2 vector that encodes for an N-terminal His-tag as well as a C-terminal Avi-tag (GenBank: JF912191) using an In-Fusion HD Cloning System kit (Takara), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The HEK293-based Lenti-X 293T (HEK293T) cell line was obtained from Takara Bio (Shiga ...
-
bioRxiv - Biochemistry 2020Quote: ... HA-tag polyclonal Antibody (631207) was from Clontech.
-
bioRxiv - Cancer Biology 2022Quote: Before undergoing ThruPLEX Tag-seq library preparation (Takara), samples were concentrated to 10μl using a vacuum concentrator (SpeedVac) ...
-
bioRxiv - Microbiology 2023Quote: ... GFP tag (JL-8 monoclonal antibody from Takara), and mCherry (polyclonal antibody from Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...