Labshake search
Citations for Takara Bio :
1 - 50 of 1194 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 10 ng cDNA of various tissues (Takara Human MTC panel I & II) were used for each reaction and amplified by KOD Xtreme Hot Start DNA polymerase kit (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Zoology 2021Quote: ... 10 μL of 2×SYBR Green Premix (Takara, Japan), and 6.8 μL ddH2O ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of 2× One Step RT-PCR buffer (TaKaRa), and 5 μL ddH2O ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... Colony PCR reaction contained 10 μl 2×La Taq Mix (Takara), 1 μl colony ...
-
bioRxiv - Cancer Biology 2019Quote: ... The human patient PDX cell lines were maintained in RPMI-1640 medium containing 10% FBS (Clontech). KRAS mutation status ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μl reaction mixture contained 10 μl 2×TB green Premix DimerEraser (Takara), 1 μl of each primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus; Takara, Dalian, China), 0.8 μL of each primer (Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus) (Takara, Beijing, China), 0.8 μL of 10 μM bidirectional primers (Table 1) ...
-
bioRxiv - Genomics 2019Quote: ... We mixed 2 µg of total RNA with 1 µl 10 mM dNTPs (Clontech #639125) and 1 µl of 50 µM SMART_dT18VN primer (for a complete list of primer sequences ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Genomics 2019Quote: ... in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 2 μL of cDNA ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Plant Biology 2021Quote: ... medium and 10-fold dilutions of these cultures were dropped on SD control (−2) and selective medium additionally lacking His (−3) (Clontech). Empty vectors were used as negative controls ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were then co-transfected with 150 ng of the pBiFC-HA-Casp2(S384E)-VC155 and pBiFC-HA-Casp2(S384E)-VN173 (mouse caspase-2) for BiFC and 10 ng of pDsRed-Mito (Clontech) as a transfection reporter plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Neuroscience 2021Quote: Human Brain Total RNA (Takara Cat. #636530) and Human Brain Cerebral Cortex Total RNA (Takara Cat ...
-
bioRxiv - Microbiology 2019Quote: Human fetal NSCs were purchased from Clontech (human neural cortex ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney (HEK293T) cells (632180; Takara) were cultured in DMEM (10-013-CV ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney epithelial Lenti-X293T (Clontech) cells were cultured in complete DMEM (Sigma Aldrich ...
-
Replication Timing and Transcription Identifies a Novel Fragility Signature Under Replication StressbioRxiv - Genetics 2019Quote: Human foreskin fibroblasts BJ-hTERT cells (Clontech) were grown in DMEM supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Human cardiomyocyte cells were purchased from Takara Bio (ref Y10060) ...
-
bioRxiv - Cell Biology 2020Quote: ... foetal bovine serum or 10% (v/v) TET System–approved FCS for U–2–OS reporter cell lines (631106, Takara Bio). U–2–OS-pEP15 cells (5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in a 20 µL reaction consisting of 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus; TaKaRa, Dalian, China), 1 µL each of forward and reverse primer ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Biophysics 2019Quote: A cDNA encoding human DBNL was amplified by PCR from Human Brain Whole QUICK-Clone™ cDNA (Clontech Laboratories) using the primers ...
-
bioRxiv - Genomics 2021Quote: U2OS (human bone osteosarcoma epithelial, female, ATCC HTB-96) and LentiX 293T (human embroyonic kidney epithelial, female, Takara 632180) cells were cultured in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...