Labshake search
Citations for Takara Bio :
1 - 50 of 382 citations for Influenza Virus Hemagglutinin HA H7N9 Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... containing a c-terminal Influenza Hemagglutinin (HA) reporter tag was cloned into the backbone pLX317-empty using the In-Fusion cloning kit (Clontech). The backbone was cut with BamHI and EcoRI.
-
bioRxiv - Developmental Biology 2020Quote: ... and Zfp131 cDNAs were fused to 1x hemagglutinin (HA) tag and cloned into p2lox plasmid using In-fusion (Clontech) cloning ...
-
bioRxiv - Microbiology 2021Quote: ... Then PCR application using specific primer pairs (Supplemental Table 2) designed for H7N9 virus and Takara One-step RT-PCR kit (Takara, China) segment by segment ...
-
bioRxiv - Biochemistry 2020Quote: ... HA-tag polyclonal Antibody (631207) was from Clontech.
-
bioRxiv - Microbiology 2019Quote: ... Whole genomic amplification of the influenza virus was conducted using Ex Taq™ Hot Start Version (TaKaRa). Forward primers were Uni-1.5 and Uni-0.5 mixed in a ratio of 3:2 ...
-
bioRxiv - Microbiology 2023Quote: ... FluPol Zhejiang-H7N9 was then purified using His60 NiNTA Superflow resin (Takara Bio) from the soluble fraction ...
-
bioRxiv - Microbiology 2021Quote: Expression plasmids encoding for human ZMPSTE24 with and without a C-terminal FLAG-tag or HA-tag were PCR amplified and subcloned into the pQXCIP (Clontech) backbone using flanking restriction sites AgeI and BamHI ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA fused to a C-terminal HA tag was subcloned into pQXCIH (Clontech) in between the NotI and PacI sites to obtain the pQXCIH-TMPRRS2-HA vector.
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The codon optimized sequence for human GPRC5D expression in mammalian cells was synthetized by Integrated DNA Technologies as a gene block and inserted into a pcDNA3.1 vector including a C-terminal HA-tag using In-Fusion HD Cloning technology (Clontech). The full-length sequences of all the orphan GPCRs (except GPR158 and GPR179 ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcloned into a pcDNA3.1 vector for mammalian expression and a C-terminal HA-tag (YPYDVPDYA) was add using In-Fusion HD Cloning technology (Clontech). A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech ...
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Cancer Biology 2023Quote: ... virus-containing media was harvested for virus isolation using Lenti-X concentrator (Takara) in lieu of ultracentrifugation ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA (Clontech), anti-GST (Santa Cruz Biotechnology) ...
-
bioRxiv - Cell Biology 2024Quote: ... and cloned into pCMV-HA-N or pCMV-HA-C (Clontech). Notably ...
-
bioRxiv - Developmental Biology 2022Quote: ... Virus containing supernatant was collected and virus particles were concentrated by Lenti-X concentrator (Clontech Laboratories, CA) according to the manufacturer protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and VSV-G were co-transfected with each lentiviral vector (pCW-RELA-HA, pCW-C11orf95fus1-HA, or pCW-C11orf95-RELAfus1-HA) into Lenti-X 293T cells (Clontech), seeded the day before in 6-well plates at a concentration of 1.2×106 cells per well ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Biophysics 2022Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and resuspended in DPBS before being applied to neurons.
-
bioRxiv - Cell Biology 2022Quote: ... The virus titer (ifu/ml) defined by Clontech’s Lenti-X qRT-PCR Titration Kit (Cat ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... Virus was precipitated using Lenti X-concentrator (Takara) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and titer quantified using p24 ELISA antigen assay (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... pQCXIP encoding Etr1-HA (Clontech) and pCIG-B72 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... has been acquired from Takara Bio.
-
bioRxiv - Synthetic Biology 2024Quote: ... has been acquired from Takara Bio.
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... HA-APOBEC3G was cloned using cDNA from TZMbl cells in pCMV-HA vector from Clontech, USA ...
-
bioRxiv - Cell Biology 2022Quote: 1000-3000 EpCam+ Trpm5-GFP+ cells from mice at day 43 post-influenza were sorted directly into lysis buffer from Takara SMART-Seq v4 and RNA / cDNA was amplified according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-GFP-tag (Living Colors 632592; Clontech), anti-Strep-tag (34850 ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech). Lentivirus titers from 48h and 72h were determined by plaque assay (data not shown ...
-
bioRxiv - Immunology 2019Quote: ... and virus was concentrated using Lenti-X Concentrator (Takara). Existing mIRAK1mCherry and Irak1−/− iBMDM were then transduced with concentrated lentivirus ...
-
bioRxiv - Genomics 2021Quote: ... and virus was collected with LentiX Concentrator (Takara, # 631232). HUVEC were infected with combinations of two viruses and used 96 h after infection ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech), and suspended in PBS.
-
bioRxiv - Microbiology 2019Quote: ... Virus packaging was assessed using Lenti-X GoStix (Clontech) but virus titers were not otherwise measured ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus was extracted using Lenti-X concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus was extracted using Lenti-X concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Virus was concentrated using LentiX concentrator (Takara, Shiga, Japan).
-
bioRxiv - Immunology 2023Quote: ... the virus was concentrated using RetroX concentrator reagent (Takara). Meanwhile ...
-
bioRxiv - Cancer Biology 2023Quote: ... Virus was concentrated with Lenti-XTM Concentrator from Takara and re-suspended in NeuroCultTM NS-A Complete Media.
-
bioRxiv - Microbiology 2023Quote: ... pCMV-HA-N2 (Takara Bio Inc.,), pET28a(+ ...
-
bioRxiv - Cancer Biology 2019Quote: ... BirA(R118G)-HA from pcDNA3.1 MCS-BirA(R118G)-HA plasmid was cloned into pRetroX-Tight-Pur (Clontech) at EcoRI site by PCR to get pRetroX-MCS-BioID-HA vector ...
-
bioRxiv - Microbiology 2019Quote: Full length Sarm1 with a C-terminal V5 tag or the V5 tag alone was cloned into the pLVX-IRES-Puro lentiviral vector (Clontech) and transfected into 293T cells along with gag/pol and VSV-G expression plasmids to generate lentiviral particles ...
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...