Labshake search
Citations for Takara Bio :
1 - 50 of 539 citations for IL 5 Rat CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... were cotransfected into CHO-tetON cells (Clontech). Stably expressing cell lines were selected for by the addition of 1mg/mL hygromycin B to the media and single colonies were picked to generate monoclonal stable cell lines ...
-
bioRxiv - Cell Biology 2020Quote: ... CHO-K1 cells were transfected with ACP-human IR plasmid using Xfect transfection reagent (Takara). 1 day after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... CHO-K1 cells were co-treated using 1μg/mL doxycycline (Takara Bio Europe, Clontech Inc.) along with the small molecules for experiments as described in main text.
-
bioRxiv - Bioengineering 2019Quote: ... HEK293T and CHO-K1 cell lines were ordered from American Type Culture Collection (ATCC) and HEK293-tetON cells and CHO-tetON cells were purchased form Clontech (Takara Bio). Synthetic DNA was ordered from Twist Bioscience.
-
bioRxiv - Cell Biology 2021Quote: ... CHO-K1 cells were co-treated using 1μg/mL doxycycline (Takara Bio Europe, Clontech Inc.) along with the small molecules for experiments as described in main text.
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-E-Cadherin (TAKARA; M110), rat anti-Endomucin (Santa Cruz ...
-
bioRxiv - Pathology 2022Quote: ... Rat anti Mouse OCN (Takara, M188); Rabbit anti Mouse MGST1 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat Shank3 deletion constructs in pmRFP-N3 (Clontech) were described before (23) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-CDH1 (M108, Takara Biosciences, 1:500), rabbit anti-FOXA2 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Rat anti-E-cadherin mAb (ECCD2; M108, Takara Bio), mouse anti-α-tubulin mAb (14-4502-82 ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies used were: rat monoclonal mCherry (1:2000, Clontech); mouse monoclonal tyrosine hydroxylase (TH ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-E-cadherin rat monoclonal antibody (Takara, M108, 1:500), anti-GFRα1 goat polyclonal antibody (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... and rat anti-E-cadherin (1:200, Takara Bio, M108). Next ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Neuroscience 2019Quote: Rat HRI was cloned into the Tet on-off system from Clontech (Tet-On® 3G Bidirectional Inducible Expression System with ZsGreen1 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-GFP (1:200;) and rabbit anti-dsRed (1:600; Clontech). The anti-GFP and anti-dsRed antibodies were used to amplify the intrinsic fluorescent signals in the Ccr2RFP/+fmsEGFP/+ mice ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and the expression of IFN-β and IL-6 were measured by quantitative PCR (TAKARA, RR820A). The sequences of the primers were listed in the Supplementary Table 4.
-
bioRxiv - Neuroscience 2021Quote: ... 5’RACE was carried out using a 5’ Full RACE Core Set (Takara Bio). The first PCR was performed using the single strand cDNAs concatenated by T4 RNA ligase and primers S1 (5’-TTC TAT ACC ATC GTC TAC CCG CTG AGC TTC-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Molecular Biology 2021Quote: The 5′ RACE analysis was conducted using the 5′ -Full RACE Core Set (Takara), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... pVSV-G (PT3343-5, Clontech) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pEco (Takara, #PT3749-5). Cells transduced with the retrovirus were sorted for EGFP positive by flow cytometry ...
-
bioRxiv - Neuroscience 2020Quote: ... and Doxycycline (5 μM, Clontech) on day 4 ...
-
bioRxiv - Neuroscience 2020Quote: ... and Doxycycline (5 μM, Clontech) on day 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Cell Biology 2024Quote: ... pVSV-G (PT3343-5, Clontech) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA samples were isolated from the rat liver using RNAiso Plus (D9109; TaKaRa, Dalian,China). RNA samples were converted to cDNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Ank only) rat Shank3 with a C-terminal mRFP-tag were generated in pmRFP-N3 (Clontech). A construct coding for N-terminally GFP-tagged full-length rat Shank3 in the pHAGE vector was obtained from Alex Shcheglovitov (Univ ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Txn1 cDNAs were amplified by PCR using LA-Taq polymerase (Takara Bio Inc, Shiga, Japan) with FW-primer ...
-
bioRxiv - Molecular Biology 2023Quote: We extracted total RNA from rat cells and tissues employing the TRIzol reagent (D9108A, TaKaRa Bio). The RNA was then reverse-transcribed into complementary DNA (cDNA ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...
-
bioRxiv - Microbiology 2020Quote: ... 5’ ends of the viral genome were analyzed by 5’-Full RACE Core Set (TaKaRa) and the PCR products of 5’ RACE were cloned using pGEM®-T Easy Vector Systems (Promega ...
-
bioRxiv - Genetics 2022Quote: The 5’end of the cloned fragment was amplified with a 5’RACE kit (Takara). The 5’RACE adaptor in the kit was used to evaluate the mRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and 5 mg/mL Doxycycline (Clontech).