Labshake search
Citations for Takara Bio :
1 - 50 of 6495 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and ssDNA (M13mp18 single-stranded virion DNA, TaKaRa Bio, Kusatsu, Japan) were added in proportions of (in % ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Cell Biology 2023Quote: Single-stranded cDNA is synthesized from total RNA by cDNA synthesis kit (TAKARA) by priming at 65 ℃ and reverse transcription for 1 h at 42 ℃ in a 20 µl reaction mixture.
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Molecular Biology 2022Quote: Single-cell K562 libraries were prepared using the SMART-seq Stranded (SSS) Kit (Takara Bio), following the manufacturer instructions with modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... and DNA Single Index Kit - 12S Set A (Takara) according to manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... single-stranded cDNA was generated from RNA using the SMARTer cDNA synthesis kit (Clontech, Palo Alto, CA) with tagged oligo-dT primers that include one of eight 15-bp barcodes to distinguish individual samples (2 species x 2 tissues x 2 biological replicates) ...
-
bioRxiv - Molecular Biology 2022Quote: Single cells were prepared using the STORM-seq protocol (referencing the SMART-Seq Stranded Kit – Takara Bio) on the SPT Labtech Mosquito (HV) ...
-
bioRxiv - Developmental Biology 2021Quote: The reverse-stranded total RNA-seq libraries (Fig. 4 and Fig. S2A) were prepared using the SMARTer-Seq Stranded kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... converted to single stranded cDNA and amplified using the SMARTer PCR cDNA Synthesis Kit (Takara Bio, Kusatsu, Japan), and IsoSeq libraries were constructed with equimolar cDNA fractions (0.5X and 1X ...
-
bioRxiv - Neuroscience 2019Quote: ... Single stranded cDNA from the total RNA was synthesized with a RT-PCR kit (Clontech, Mountain View, CA) according to the kit’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Pathology 2020Quote: ... Single stranded cDNA was synthesized with the oligo(dT) primer using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara), the obtained cDNAs were analyzed by real-time PCR ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... One microgram of total cellular RNA was converted to single-stranded cDNA using the PrimeScript 1st Strand cDNA Synthesis Kit (Takara Bio). The cDNA (1 μl ...
-
bioRxiv - Physiology 2020Quote: ... 1μg RNA was reverse transcribed into single-stranded cDNA using the SuperScript First-strand Synthesis Kit (Takara Bio Inc., Tokyo, Japan). Gene-specific primers were designed by Beacon Designer 7.9 software (Premier Biosoft International ...
-
bioRxiv - Systems Biology 2020Quote: ... SMARTer Stranded RNA-Seq Kit (Clontech) was used according to the manufacturer’s instructions to prepare sequencing libraries ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting double-stranded cDNA’s were further processed to DNA sequencing libraries using ThruPLEX DNA-seq 12S Kit (R400428, Clontech Laboratories). Libraries were size-selected by gel purification for an average size of 350bp ...
-
bioRxiv - Genomics 2023Quote: ... double-stranded DNA library libraries from the size fractionated samples were constructed using the ThruPLEX DNA-seq Kit (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: ... and indexing were performed as previously described using the Qiagen AllPrep DNA/RNA Micro Kit and the SMARTer Stranded Total RNA-Seq Kit v2 (Takara) (46 ...
-
bioRxiv - Neuroscience 2020Quote: ... with double-stranded DNA dye SYBR Green (RR091A, Takara, Japan). Complementary DNA from various cell samples or hippocampal tissue samples were amplified with specific primers (Lox ...
-
bioRxiv - Cancer Biology 2022Quote: ... with SMART-Seq Stranded Kits (Takara Bio, USA) to reach at least 50 Mio ...
-
bioRxiv - Neuroscience 2022Quote: ... Single-indexed libraries were generated using ThruPLEX® DNA-seq Kit (Takara Bio Inc., Shiga, Japan), pooled and checked again using a Bioanalyzer (Agilent High Sensitivity DNA Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... and genomic DNA amplification was carried out using the PicoPLEX Single Cell WGA kit v3 (Takara) and following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Double stranded complementary DNA (dscDNA) was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Double stranded complementary DNA (dscDNA) was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... a single-stranded donor for homologous recombination was generated using the Guide-it Long ssDNA Production System (Clontech). The gRNA ...
-
bioRxiv - Pathology 2022Quote: ... Single-stranded cDNA was reverse transcribed using Prime Script RT Master Mix (Perfect Real Time) (Takara Bio Inc.), and used for subsequent real-time PCR reactions ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were constructed using synthetic double-stranded DNA (Integrated DNA Technologies) and In-Fusion cloning (Takara) into the pL6 plasmid ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was extracted from E8.5 trunk tissue (two wild-type trunks and two Aldh1a2-/- trunks) and DNA sequencing libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 Pico Input Mammalian (Takara). Sequencing was performed on Illumina NextSeq 500 ...
-
bioRxiv - Genomics 2021Quote: ... SMART-Seq Single Cell Kit (Takara Bio) libraries were prepared following the manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA was reverse-transcribed to single-stranded cDNA using the AMV Reverse Transcription System (Takara, Dalian, Liaoning, China). Then ...
-
bioRxiv - Plant Biology 2024Quote: Single or multiple DNA fragments were cloned into binary vector using In-Fusion HD Cloning Kit (Clontech, USA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... TAKARA Bio SMART-Seq Stranded Kit User Manual (TAKARA Bio) was used with the following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... SMARTer Stranded Total Sample prep kit-HI Mammalian (Takara, 634875) was used to generate libraries for RNA sequencing.
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared using SMART-Seq Stranded Kit (Takara Bio). The quality ...
-
bioRxiv - Immunology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Physiology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Cell Biology 2023Quote: ... Single-stranded cDNA was reverse transcribed from 500ng total RNA using reverse transcriptase and oligo(dT) primer (Takara, Catalog#RR036). Real-time qPCR amplification was performed using the PrimeScript™ RT-PCR Kit (Takara ...
-
bioRxiv - Cell Biology 2020Quote: ... putative miR-31-5p binding sequences were deleted in the plasmid DNA using PrimeSTAR Mutagenesis Basal Kit (TaKaRa Bio, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were added to the lysates of single parasites and libraries were prepared using SMART-Seq v.4 Ultra Low Input RNA Kit (Takara) using a quarter of the reagent volumes recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: Single or multiple DNA fragments were cloned into fungal transformation vector using In-Fusion HD Cloning Kit (Clontech, USA). Briefly ...
-
bioRxiv - Genomics 2024Quote: SMART-Seq Single Cell PLUS kit (Takara Bio) was used for cDNA library construction ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA libraries were generated using the SMART-Seq Stranded Kit (Takara). This kit incorporates SMART® cDNA synthesis technology (28 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and SMARTer Stranded Total RNA-Seq Kit - Pico Input (Clontech; 635005) and sequenced on the Illumina HiSeq 2500 sequencer (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... and library preparation using the SMARTer stranded RNA-seq Kit (Clontech). DNA libraries were quantified with KAPA Library Quantification Kit for Illumina (Kapa Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... such as for the SMARTer Stranded Total RNA Kit (Takara, 634862), SMART-Seq RNA Kit (v4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The SMARTer Stranded Total RNA-Seq Kit - Pico Input Mammalian (Clontech Laboratories ...
-
bioRxiv - Developmental Biology 2022Quote: ... SMARTerR Stranded Total RNA-seq kit v2-Pico InputMammalian (Takara Clontech) was used ...