Labshake search
Citations for Takara Bio :
1 - 50 of 4924 citations for Human STEAP family member 1B STEAP1B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Con 1B and Con 2B were purchased from Takara Bio Inc (ChiPSC-6b ...
-
bioRxiv - Microbiology 2022Quote: ... using the primers listed in S-Table 1B into pcDNA3.1-P2A-tagRFP by the In-Fusion HD Cloning Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and titer quantified using p24 ELISA antigen assay (Takara). MOI=5 was used to transduce 1x1097 EndoC-βH3 cells in culture media without pen/strep and puromycin.
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Molecular Biology 2023Quote: ... and CDS of fluorescent proteins were subcloned into pET-human αSyn51 using the KOD-Plus Mutagenesis kit (TOYOBO) and In-Fusion HD Cloning Kit (Takara Bio) according to the manufacturers’ protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mtDNA copy number was determined by quantitative PCR with Human mitochondrial to nuclear DNA ratio kit (Takara Bio USA, 7246).
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... Illumina data from human HEK293T cells were processed with the SMARTer® smRNA-Seq Kit for Illumina (Takara, Cat. Nos. 635029) following guidelines ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Neuroscience 2021Quote: Human Brain Total RNA (Takara Cat. #636530) and Human Brain Cerebral Cortex Total RNA (Takara Cat ...
-
bioRxiv - Microbiology 2019Quote: Human fetal NSCs were purchased from Clontech (human neural cortex ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney (HEK293T) cells (632180; Takara) were cultured in DMEM (10-013-CV ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney epithelial Lenti-X293T (Clontech) cells were cultured in complete DMEM (Sigma Aldrich ...
-
Replication Timing and Transcription Identifies a Novel Fragility Signature Under Replication StressbioRxiv - Genetics 2019Quote: Human foreskin fibroblasts BJ-hTERT cells (Clontech) were grown in DMEM supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Human cardiomyocyte cells were purchased from Takara Bio (ref Y10060) ...