Labshake search
Citations for Takara Bio :
1 - 50 of 5033 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and human-specific GFAP marker STEM123 (TaKaRa, cat. Y40420). As general astrocyte markers GFAP (DAKO ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Cell Biology 2023Quote: We used an hESC line that transiently expresses the C-terminal region (catalytic domain) of histone demethylase JMJD3 in a doxycycline (DOX, Takara Bio Inc, Japan) inducible manner (12 ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Molecular Biology 2021Quote: Genes of interest were amplified from genomic DNA of W303-1A and cloned into the respective vector using the In-Fusion HD cloning kit (Clontech). Mutations and deletions were introduced by oligonucleotide-directed site-specific mutagenesis.
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Biochemistry 2021Quote: ... and Proteinase K (Takara). Polymerase chain reaction (PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Microbiology 2020Quote: ... Strand-specific libraries were prepared using the SMART-seq Ultralow RNA input kit (Takara), insert sizes checked with the Bioanalyzer RNA pico kit (Agilent) ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and proteinase K (9034, Takara Bio). The reactions were terminated by addition of 15% trichloroacetic acid ...
-
bioRxiv - Genetics 2024Quote: ... then digested with Proteinase K (Takara) at 55lJ overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... Site-specific mutagenesis was achieved using PCR with a Prime STAR Mutagenesis Basal Kit (Takara).
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The full-length cDNA of the human ZNRF3 was acquired from the human CRC DLD-1 cell line by RNA purification using NucleoSpin RNA II kit (Macherey Nagel) and reverse transcription RT-PCR using specific primers and Primescript RT reagent kit (TaKaRa). Then the ORF of the ZNRF3 short variant replaced RNF43 and was assembled into the C-terminal FLAG-tagged vector using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was amplified with a SYBR Green dye kit and gene-specific primers (Takara, Shiga, Japan). Data were normalized to β-actin mRNA levels ...
-
bioRxiv - Genomics 2020Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-seq Kit (Clontech), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Genomics 2023Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-seq Kit (Clontech), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Strand-specific libraries were constructed using the SMARTer Stranded Total RNA-seq Kit (Takara catalog: 634862) following ribosomal RNA removal using RiboGone (Takara catalog ...
-
bioRxiv - Cancer Biology 2019Quote: ... and specific primer sets (Takara Bio), as described in a previous report (Inui et al ...
-
bioRxiv - Genetics 2019Quote: ... and specific bands were cleaned using NucleoSpin gel clean-up kit (Takara Bio, Mountain View, CA, U.S.A.) for subsequent Sanger sequencing at UMGC ...
-
bioRxiv - Cell Biology 2020Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-Seq Kit (Clontech # 634839), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-Seq Kit (Clontech #634839), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 250 μg/mL proteinase K (Takara, Dalian), incubated at 55 °C for 1h ...
-
bioRxiv - Genetics 2021Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-Seq HT Kit (Clontech #634839), according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: TssM193-490 coding region was obtained by gene synthesis (IDT) and cloned into pOPIN-K vector45 using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were introduced using the QuikChange Lightning kit (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... PK-15 cells were transfected with PX459-Ifnar1-k/o or PX459-Stat2-k/o plasmids using the TransIT-X2 Dynamic Delivery System (TaKaRa, Cat# V6100) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reactions were performed with gene-specific forward and reverse primers using the PrimeScript RT-PCR kit (TaKaRa) on the StepOne Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cDNA was amplified with gene-specific primers (Supplemental Table 1) and SYBR Premix Ex Taq II kit (TaKaRa). Data were analyzed using a 2−ΔΔCt method.
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Bioengineering 2022Quote: ... Purified insert DNA was cloned into the linearized modRNA plasmid (5MCS3)(K et al., 2018) using the In-Fusion Cloning Kit (Takara Bio). The DNA template for modRNA synthesis was PCR amplified from the successfully cloned 5MCS3 plasmid followed by PCR purification using DNA Clean & Concentrator-5 (Zymo Research) ...
-
bioRxiv - Biochemistry 2023Quote: TssM193-490 coding region was obtained by gene synthesis (IDT) and cloned into pOPIN-K vector45 using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were introduced using the QuikChange Lightning kit (Agilent Technologies).
-
bioRxiv - Molecular Biology 2021Quote: ... 12.5 mM HEPES-KOH (pH7.4) and 12.5% Proteinase K (TaKaRa)] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Five microliters of DNase I (15 K units, TaKaRa Bio), 0.2 U/μL of ribonuclease inhibitor (porcine liver ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5% SDS) and 50 μl of proteinase K (Takara, 9034) were added ...
-
bioRxiv - Neuroscience 2023Quote: ... pH 8.5) containing proteinase K (Takara Bio Inc., Otsu, Japan). This mixture was incubated at 55 °C for at least 12 hours ...