Labshake search
Citations for Takara Bio :
1 - 50 of 6474 citations for Human High Sensitive Leucine Rich Alpha 2 Glycoprotein 1 LRG1 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and selected on DDO (Synthetic Dropout Medium/-Tryptophan-Leucine) and TDO (Synthetic Dropout Medium/-Tryptophan-Histone-Leucine) media (Clontech) with corresponding concentration of 3-AT ...
-
bioRxiv - Plant Biology 2023Quote: ... Probes were detected with sensitive HRP substrates (Takara), and an iBrightTM CL750 Imaging System.
-
bioRxiv - Immunology 2021Quote: ... or Western BLoT Ultra Sensitive HRP Substrate (Takara Bio).
-
bioRxiv - Plant Biology 2022Quote: ... Transformants were selected on Synthetic Defined (SD) media lacking Leucine and Tryptophane (Clontech). Three individual clones were grown ON in liquid cultures (lacking Leucine and Tryptophane ...
-
bioRxiv - Microbiology 2021Quote: ... or Western BLoT Ultra Sensitive HRP Substrate (Takara, Cat# T7104A) according to the manufacturers’ instruction ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Virus-rich supernatants were concentrated using Lenti-X™ Concentrator (Takara Bio, 631231) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR polymerase capable of handling GC-rich amplicons was used (PrimeSTAR GXL Premix, Clontech). The resulting DNA amplicon ...
-
bioRxiv - Microbiology 2023Quote: ... Chemiluminescence was detected using Western BLoT Ultra Sensitive HRP Substrate (T7104A, Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
bioRxiv - Immunology 2022Quote: ... The signal was detected using the Western Blot Ultra-Sensitive HRP Substrate (Takara) and imaged using the Fusion FX Imaging system (PeqLab Biotechnologie).
-
bioRxiv - Biochemistry 2020Quote: ... pGAD plasmids were transformed into PJ49-4a yeast and were selected on leucine-dropout medium (Clontech, #630414). pTEF or pTEFdual plasmids were included to express proteins in trans and were transformed with pOBD plasmids and selected on media lacking tryptophan and uracil (Sunrise Science Products ...
-
bioRxiv - Genetics 2022Quote: ... GenTLE (from yeast) high recovery kit (Takara Bio). The genomic DNA concentration was measured using the Quantifluor® ONE dsDNA Dye System (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Molecular Biology 2022Quote: ... GenTLE (from Yeast) High Recovery Kit (9082, Takara Bio). The genomic DNA concentration was quantified using the Quantifluor® ONE dsDNA Dye System (E4971 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the High-Capacity cDNA Reverse Transcription Kit from TAKARA was used ...
-
bioRxiv - Immunology 2023Quote: ... and 1 µg was used for cDNA synthesis with the PrimeScript High Fidelity RT-PCR Kit (Takara, R022B). Of the cDNA ...
-
bioRxiv - Genomics 2021Quote: ... PrimeScript High Fidelity RT-PCR Kit (Takara Bio, Japan, R022A), In-Fusion Snap Assembly Master Mix (Takara Bio ...
-
bioRxiv - Developmental Biology 2020Quote: ... PrimeScript II High Fidelity One step RT-PCR Kit (Takara) was used with the following primers ...
-
bioRxiv - Immunology 2022Quote: ... A high-fidelity Advantage HF2 PCR kit (Takara, Cat#639123) was used in each of the PCR steps involved in preparing the sequencing libraries ...
-
bioRxiv - Physiology 2021Quote: ... the pSTT91 and pGAD424 plasmids cloned with potential interactors were introduced into the Saccharomyces cerevisiae strain L40 and grown for 2 days at 30°C on a leucine- and tryptophan- deficient synthetic defined premixed yeast growth medium (SD-Leu-Trp, TaKaRa Clontech)(Hollenberg et al. ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl purified cDNA was amplified with an Advantage HF 2 PCR kit (Takara) in a 25 µl reaction containing 0.5 µl forward primer (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Physiology 2021Quote: ... the pSTT91 and pGAD424 plasmids cloned with potential interactors were introduced into the Saccharomyces cerevisiae strain L40 and grown for 2 days at 30°C on a leucine- and tryptophan- deficient synthetic defined premixed yeast growth medium (SD-Leu-Trp, TaKaRa Clontech)(Hollenberg et al. ...
-
bioRxiv - Genetics 2022Quote: ... the ptetO7-ALA1 strain was transformed with a vector (pAG425) to express wild-type or mutant AARS1 and grown on media lacking leucine (DO Supplement -Leu, Takara Bio). One colony was picked ...
-
bioRxiv - Plant Biology 2023Quote: ... were used to co-transform yeast strain AH109 and colonies carrying both vectors were selected on SD medium without tryptophan (-W) and leucine (-L) (TaKaRa 630317) at 28°C ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... GenTLE™ High Recovery for Yeast Kit (Takara Bio Inc., Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... with insertion of N-terminal residues MATLEK a part of the N17 domain and C-terminal residues PQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRP which comprise the PR (proline-rich) domain containing the C38 domain using primers as a part of In-Fusion cloning protocol (Takara). eGFP-PolyQ31 was adapted from eGFP-PolyQ74 through the variability of Q-length PCR products amplified using CloneAmp HiFi PCR Premix (Takara) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Advantage GC 2 PCR Kit (Takara) was used for gene cloning ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to the target sequence on M ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Genomics 2019Quote: ... and an Advantage 2 PCR Kit (Clontech) were used for cDNA generation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Cancer Biology 2020Quote: ... after purification and used a high-capacity cDNA reverse transcription kit (Takara) to reverse transcribe RNA into first-strand cDNA ...
-
bioRxiv - Neuroscience 2023Quote: The high-quality human total brain RNA that was used for 3’ RACE was purchased from Clontech (Mountain View, CA). SCA12 KI-10 and KI-80 mouse models were generated using the CRISPR/Cas9 approach by replacing the mouse PPP2R2B exon 2 with the human PPP2R2B exon 7 containing either 10 or 80 CAG triplets (Li and Margolis ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Microbiology 2019Quote: ... Each fragment was cloned into SmaI-digested temperature-sensitive vector pTH18ks1 (41) in Escherichia coli DH5α (Takara Bio Inc.).