Labshake search
Citations for Takara Bio :
1 - 50 of 5491 citations for Human Cytochrome P450 Family 4 Subfamily F Member 2 CYP4F2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: The coding region of each P450 gene was cloned into pCAMBIA1390 vector with the In-Fusion DH Cloning Kit (TaKaRa, Kusatsu, Japan) or SLiCE reaction (Motohashi ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and human adult heart RNA (n=4 pooled, Cat #636583, Takara) were used for bulk RNA sequencing ...
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Neuroscience 2021Quote: ... pDsRed monomer-F (Clontech), or iRFP670 (kindly gifted from Prof ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... red fluorescent protein fused with the mitochondrial targeting sequence from cytochrome c oxidase subunit VIII (Clontech, Mountain View, CA) using Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Physiology 2020Quote: ... N-glycosidase F (PNGase, Takara, 4450) was used as previously reported [22] ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Immunology 2021Quote: ... Single stranded cDNA was synthesized immediately by adding 0.7 µl SMARTScribe reverse transcriptase (100 U/µl, f/c 2 U/µl, Takara Bio #639537), 7 µl First-Strand buffer (f/c 1×) ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Advantage GC 2 PCR Kit (Takara) was used for gene cloning ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to the target sequence on M ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Genomics 2019Quote: ... and an Advantage 2 PCR Kit (Clontech) were used for cDNA generation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Immunology 2023Quote: ... Kit Advantage 2 PCR Enzyme System (Clontech, 639206), QIAquick Gel Extraction ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Plant Biology 2021Quote: ... The amplicons from SlACS2-prom1k-pPLV-F/R were cloned into pPLV451 using an In-Fusion HD Cloning kit (Clontech), to construct pACS2-GFPx3 and pACS2mut-GFPx3 ...
-
bioRxiv - Biochemistry 2021Quote: ... falciparum cDNA followed by Ligation Independent Cloning into HindIII/KpnI-cleaved plasmid pOPIN F (82) using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were co-transfected with pEGFP-F (Clontech), pDsRed monomer-F (Clontech) ...
-
bioRxiv - Biochemistry 2021Quote: ... falciparum cDNA followed by Ligation Independent Cloning into HindIII/KpnI-cleaved plasmid pOPIN F (82) using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 2× SYBR Green qPCR Mix Kit (TaKaRa, Japan) and the cDNA concentration and primers described above were used ...
-
bioRxiv - Immunology 2022Quote: ... before amplification using the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Bioengineering 2023Quote: ... quantified via qPCR (AAVpro Titration Kit version 2; Clontech), and stored at 4°C until use.
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the Advantage® 2 PCR Kit (Takara Bio) in a touchdown cycling program as follows ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... Transient retroviral supernatants were produced as previously described.44 Activated NK cells were purified and transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Systems Biology 2024Quote: SW1353 cells were purchased from ATCC Full length miRNA target 3’UTRs were amplified from human genomic DNA using PCR primers (Supplementary Table 4) to enable Clontech In-Fusion HD cloning (Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...