Labshake search
Citations for Takara Bio :
1 - 19 of 19 citations for Elabela 19 32 TFA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and 19 µL 10X lysis buffer (TaKaRa, Cat# 635013) diluted to 1X with nuclease-free water ...
-
bioRxiv - Molecular Biology 2019Quote: ... ligated into the pMD™19-T plasmid vector (Takara), and transformed chemically into Escherichia coli competent cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... sub-cloned into the pMD 19-T vector (TaKaRa, Dalian, China), transformed into Escherichia coli DH5α (TaKaRa ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged PDE5A isoforms plasmids [19] were co-transfected with pDsRed-mito (Clontech) into HEK293 cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... the amplified fragments were inserted into the pMD™ 19-T Vector (Takara) and re-sequenced ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR fragments were gel-purified and ligated into the pMD 19-T Vector (TaKaRa, Dalian, China), and confirmed by sequencing from both strands.
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified from genomic DNA with primers 19-22 and cloned into the vector pRS29 using ligation-independent cloning (In-Fusion, Clontech). A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG85 using primers 23 and 24 ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex ...
-
bioRxiv - Plant Biology 2023Quote: The nucleotide sequence (around 500 bp long) specific to the NlCA coding region was cloned into the pMD 19-T vector (TAKARA). The double-stranded RNA was synthesized through PCR amplification by using the Mega script T7 High Yield RNA Transcription Kit (Vazyme ...
-
bioRxiv - Molecular Biology 2021Quote: Gene-specific target sequences as well as a heterologous fragment from Mus musculus (Muslta) used for double-stranded RNA (dsRNA) synthesis were amplified and cloned into pMD™ 19-T Vector (Takara). Templates used for single-stranded RNA were amplified with primers that incorporated with the T7 promoter sequence (S4 Table) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were cotransfected with hSyn-DsRed and the indicated construct on DIV 7 or DIV 19 (for older neurons) with 1 μg total purified plasmid DNA via CalPhos Mammalian Transfection Kit (Takara Bio) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... nine DNA fragments encoding the partial genome of SARS-CoV-2 (hCoV-19/Japan/TY-WK-521/2020) were amplified by PCR using PrimeSTAR GXL DNA polymerase (Takara, Cat# R050A). A linker fragment encoding the hepatitis delta virus ribozyme ...
-
bioRxiv - Microbiology 2020Quote: ... Different amounts of total RNA (4, 16, 32, or 40 ng) were used for first strand synthesis using SmartScribe RT (Clontech) and Oligo(dT)23 VN primer (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... cells were harvested and resuspended in retroviral supernatant and centrifuged for 90 minutes at 1000g at 32°C on retronectin (TaKaRa) coated plates.
-
bioRxiv - Microbiology 2023Quote: The open reading frames of 19 LD-associated proteins were amplified from RIB40 genomic DNA with PrimeSTAR® HS DNA Polymerase (TaKaRa, Otsu, Japan) for high-fidelity PCR ...
-
bioRxiv - Microbiology 2021Quote: The gfp gene was PCR amplified from pBAV1K-t5-gfp[32] and cloned into pUC18T-mini-Tn7T-Zeo by In-Fusion® Cloning (Takara). The pUC18T-mini-Tn7T-Zeo-GFP vector was conjugated to Acinetobacter as described[33] ...
-
bioRxiv - Immunology 2020Quote: ... for 24 h and transduced with lentiviral particles by spinfection (1000 x g for 90 min at 32°C) in the presence of Polybrene (5 μg/ml) on the plates coated with Retronectin (50 μg/ml) (Takara/Clontech) and anti-CD3 (1–2 μg/ml) ...
-
bioRxiv - Microbiology 2020Quote: ... by standard molecular cloning methods as described in our previous publications.30-32 pISRE-Luc (the luciferase reporter of ISGs) was purchased from Clontech (USA). The SARS-CoV-2 ORF9b gene was synthesized according to the genome sequence of the SARS-CoV-2 Wuhan-Hu-1 strain (NC_045512.2 ...
-
bioRxiv - Immunology 2023Quote: ... Retroviral supernatants were then collected and spun at 2,000g for 2 h at 32 °C onto 24-well non-tissue-culture-treated plates coated overnight in Retronectin (Takara Bio) or spinfected for 90 minutes at 32°C in 1 µcg mL-1 polybrene ...