Labshake search
Citations for Takara Bio :
1 - 50 of 6311 citations for DNA Damage 8 OHdG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: Custom oligonucleotides containing 8-OHdG bases were purchased from Takara Bio Inc ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries were prepared using 1-5 ng of starting material using the SMARTer ThruPLEX DNA-Seq kit (Takara; R400674) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 U of Taq DNA polymerase (TaKaRa Bio) was subjected to PCR using a thermal cycler (Applied Biosystems 7300 real-time PCR system ...
-
bioRxiv - Developmental Biology 2024Quote: ... ThruPLEX DNA-seq Kit (Takara) was used to construct the CUT&RUN DNA library for sequencing on an Illumina platform ...
-
bioRxiv - Molecular Biology 2024Quote: ... or DNA ligation kit (Takara) and transformed into StellarTM competent cells (Takara Bio ...
-
bioRxiv - Developmental Biology 2022Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Cell Biology 2024Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the NucleoBond HMW DNA kit (Takara) per the manufacturer’s instructions with a 50 °C proteinase K incubation for 4.5 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment coding GFP was inserted at the 5’ side of SYP32 by In-Fusion HD Cloning Kit (Takara), and the whole sequence was recombined into pGWB1 by LR Clonase II ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or PrimeSTAR DNA Polymerase kit (Takara). PCR products were run on agarose gel to visualize the fragment size ...
-
bioRxiv - Genomics 2024Quote: DNA libraries were prepared using ThruPLEX® DNA-Seq Kit (Takara) and DNA Unique Dual Index Kit with associated protocols ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... ChIP-seq libraries were prepared with sheared DNA (0.5 ng of ChIP DNA or 5.0 ng of input DNA) using ThruPLEX® DNA-seq Kit (Clontech). These obtained libraries were size-selected at 300-700 bp using ×1.0 AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2020Quote: Complementary DNA (cDNA) was generated from previously extracted total RNA (900 ng) using the SMARTER RACE 5’/3’ kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV1-syn-F14F15S-sTpEptTA_v2 were made by transfecting 8×15c plates (per virus) of HEK 293T cells using Xfect transfection reagent (Takara 631318). Briefly ...
-
bioRxiv - Plant Biology 2020Quote: ... using DNA Ligation Kit
(Takara). The constructed vector was transformed into the DH5α strain of E.coli ... -
bioRxiv - Molecular Biology 2021Quote: ... and DNA Unique Dual Index Kit (Takara). The multiplexed libraries were dispatched to Eurofins Genomics Inc ...
-
bioRxiv - Microbiology 2021Quote: ... by using the DNA ligation Kit (Takara). Plasmid DNA was then linearized with the restriction enzyme XhoI ...
-
bioRxiv - Genomics 2021Quote: ... The ThruPLEX DNA-Seq Kit (Takara Bio) was used following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... or SMARTER ThruPLEX DNA-seq kit (TAKARA) and SMARTer DNA Unique Dual Index Kit (TAKARA ...
-
bioRxiv - Molecular Biology 2024Quote: ... using Random Primer DNA Labeling Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Genomics 2020Quote: ... 20 ng of sheared DNA was used for the library construction with ThruPLEX DNA Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA). Plasma and tumor DNA libraries were sequenced using paired-end 50 bp reads generated on the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Plant Biology 2022Quote: ... The DNA purification was conducted using NucleoBond® HMW DNA kit (from TaKaRa) and the purification steps were followed exactly as described in the protocol accompanying the kit ...
-
bioRxiv - Microbiology 2022Quote: ... Tick DNA was extracted using the MightyPrep reagent for DNA Kit (Takara, Japan) according to the manufacturer’s instructions ...