Labshake search
Citations for Takara Bio :
1 - 50 of 74 citations for Cytomegalovirus Glycoprotein B gB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the human cytomegalovirus (hCMV) promoter/immediate-early enhancer (IE) of peGFP-N1 (Clontech) and the chimeric intron (chI ...
-
bioRxiv - Bioengineering 2022Quote: ... gene segments of HA7 and NA9 ectodomains were cloned downstream of the cytomegalovirus promoter in pTriEx3 expression vector (Clontech). The vectors were transfected into A549 cells in 96-well microtiter plate using TransLT transfection reagent (Mirus ...
-
bioRxiv - Biochemistry 2020Quote: ... Each PCR product was subcloned into the NheI and XhoI sites of a cytomegalovirus promoter-driven pIRES2-AcGFP1 vector (Clontech Laboratories Inc. ...
-
bioRxiv - Developmental Biology 2021Quote: ... AP20187 (B/B) compound (Takara Bioscience) was injected into the dorsal aorta through a small window made in the ventral egg ...
-
bioRxiv - Biophysics 2022Quote: ... B/B homodimeriser (AP20187, Takara Bio), dibenzocyclooctyne-PEG4-maleimide (760676 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... B/B dimerizer (AP20187 ligand; TaKaRa 635058) was added to a final concentration of 500 nM in the well ...
-
bioRxiv - Immunology 2022Quote: ... B/B homodimerizer (Takara Bio, Cat#635058), b-estradiol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 nM B/B Homodimerizer (Takara, #635058) was also added ...
-
bioRxiv - Neuroscience 2023Quote: B/B homodimerizer was purchased from Takara USA lnc ...
-
bioRxiv - Pathology 2020Quote: AP21087 ((B/B homodimerizer, Takara Bio, CA, USA) was administered by intra-peritoneal (ip ...
-
bioRxiv - Cell Biology 2019Quote: ... AP20187 (B/B Homodimerizer) was purchased from Takara. The recombinant Anti-M1 Spastin rabbit monoclonal antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 500 nM of the B/B dimerizer (TaKaRa 635058) was added 2 hours before the start of the assay (or an Ethanol vehicle control was added) ...
-
bioRxiv - Immunology 2019Quote: ... B/B Homodimerizer (Takara, 635059, equivalent to AP-20187), disuccinimidyl suberate (DSS ...
-
bioRxiv - Neuroscience 2022Quote: ... AP20187 (B/B) (Clontech, Saint-Germain-en-Laye France) was added 4 h post-transfection overnight.
-
bioRxiv - Developmental Biology 2020Quote: ... 1.0 μl of 25mM B/B (in DMSO) (AP20187, Takara) was added to 50ul of PGCs (3,000 PGCs/μl ...
-
bioRxiv - Genetics 2020Quote: ... 1.0 ul of 25mM B/B (in DMSO) (Takara Bio) was added to 50ul PGC suspension before injection and subsequently 50 μl 300ul P/S (containing 30ul of 0.5mM B/B drug ...
-
bioRxiv - Biochemistry 2021Quote: ... After 16 hours of incubation with B/B homodimerizer (Takara Bio, 635059) at various concentrations ...
-
bioRxiv - Immunology 2022Quote: ... cells were stimulated with indicated concentrations of B/B homodimerizer (Takara Bio) for 15 h ...
-
bioRxiv - Neuroscience 2023Quote: ... the designed drug AP20187 (AP; B/B Homodimerizer purchased from Takara #635058) was first prepared according to manufacturer’s directions in 100% ethanol ...
-
bioRxiv - Microbiology 2019Quote: ... and hygromycin B (Clontech) were added to the medium ...
-
bioRxiv - Cell Biology 2021Quote: ... Aggregates were formed by addition of 500nM rapalog2 (Takara, B/B homodimerizer #635059) for 1 h ...
-
bioRxiv - Biophysics 2023Quote: ... Pyroptosis was induced by addition of 500nM B/B-Homodimerizer (Takara Bio, AP20187) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were exchanged with fresh media containing B/B homodimerizer (500nM) (Takara Bio, #635059) and/or Baf-A1 (100nM ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Microbiology 2019Quote: The dual-luciferase assay using an NF-□B–dependent firefly luciferase (pNF-□B-Luc; Clontech) and a Renilla luciferase driven by the thymidine kinase promoter (pRLTK ...
-
bioRxiv - Microbiology 2021Quote: ... Complete nucleoprotein and glycoprotein genes were amplified using Takara long amplicon Taq polymerase with GC buffers (RR02AG Takara Bio USA, Mountain View, CA, USA) using the primers indicated in Table 1 after cDNA synthesis using random hexamer primers and Roche AMV reverse transcriptase (10109118001 Roche ...
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... T cells were incubated at 3×104 cells/well in 96-well U bottom plates for 24 hours in T cell media containing 50 IU/mL rhIL-2 and varying concentrations of AP20187 (B/B homodimerizer, Takara, 635058). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... cultivated in mTESR1 and grown 48hrs before functionality of the suicide gene was assessed by adding the chemical inducer of dimerization (CID) (AP20187, B/B Homodimerizer, Clontech Laboratories, Inc), or AP1903 ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... 86% of 2% Tween 20 in deionized Water) or AP20187 (B/B homodimerizer, Clontech; 10 mg of AP20187 per kg body mass) twice weekly at the age of 20 months for a total of 4 months (old mice were sacrificed at 24 months of age) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 12 µg RetroNectin solution (TaKaRa Biomedicals, cat# T100A/B) in PBS was added to each well of untreated 6-well plates (Greiner ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were treated with 100ug/mL hygromycin B (Takara bio 631309). Cells were exposed to 100ug/mL hygromycin B for 8 days ...
-
bioRxiv - Immunology 2020Quote: ... plates were coated with 40 μg/mL retronectin (TAKARA, # T100A/B) overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... The SMARTer Mouse TCR a/b Profiling Kit (Takara, Cat. No. 634403) was used to amplify both TCRα and TCRβ sequences ...
-
bioRxiv - Microbiology 2023Quote: ... and MS4 (feline B-cell lymphoma) (73) using an RNAiso Plus kit (Takara), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... hygromycin B (300 µg/ml) and 10% tetracycline free fetal bovine serum (Takara Bio, USA) in a humidified incubator at 37°C in 5% CO2 in 6-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Cancer Biology 2021Quote: ... and TCR beta chain libraries were generated using SMARTer Mouse TCR a/b Profiling Kit (Clontech). Samples were pooled to a final pool concentration of 4 nM and diluted to a final concentration of 13.5 pM ...
-
bioRxiv - Cell Biology 2021Quote: ... pBos-CENP-B-GFP was constructed by replacing the H2B fragment in pBos-H2B-GFP (Clontech) with the KpnI/BamHI-digested PCR fragments encoding the centromere-targeting domain (residues 1-163 ...
-
bioRxiv - Cancer Biology 2023Quote: PDGF-IRES-Cre was generated by cloning human PDGF-B and Cre into pQXIX vector (Clontech) as previously described5 ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... DNA was purified using the standard phenol-chloroform extract method and subjected to DNase I (Takara, 2270 B) treatment and reverse transcription for DRIPc-seq library construction ...
-
bioRxiv - Developmental Biology 2021Quote: ... was inserted in a Tol2 vector containing the hsp70l:xxxp2a-TFP sequence (kind gift from Prof. B. Martin, Stony Brooks University, NY) by In Fusion (Clontech) cloning ...