Labshake search
Citations for Takara Bio :
1 - 50 of 6017 citations for Cow Polypyrimidine tract binding protein 1 PTBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Molecular Biology 2022Quote: ... individual pTRIPZ-PTBP1 vectors were co-transfected with psPAX2 and pMD2.G into Lenti-X 293T cells (Takara, 632180), and the supernatant was collected twice at 48 h and 72 h post-transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA-binding protein expressing vector was based on the shuttle vector pGADT7 (Clontech, USA) and constructed as described previously [25] ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP.
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using BCA Protein Assay Kit (TaKaRa). The samples were subjected to SDS-PAGE ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... the MS2 binding sites were amplified with primer pair 1 (Supplementary File 1: Table S4) and cloned into pEGFP-C1 (Clontech) as EcoRI/BamHI fragment ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2022Quote: ... Virus production was quantified by determining the amount of the Gag p24 protein using an enzyme-linked immunosorbent (ELISA) assay (Innogenetics or TaKaRa). For production of HIV-1 Env-pseudotyped viruses in Jurkat cells ...
-
bioRxiv - Plant Biology 2023Quote: ... and a rabbit LexA binding domain antibody (Clontech), respectively.
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Developmental Biology 2022Quote: c-Kit-EGFP fusion protein: chicken c-Kit cDNA was inserted into multiple cloning site of pEGFP-N1 Vector (Clontech, #6085-1) including EGFP sequences using a primer set ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Bioengineering 2023Quote: ... Using a BCA protein kit (TaKaRa, Shiga, Japan), a working solution (BCA reagent A ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: ... Protein purity and concentration were determined by SDS-PAGE and BCA protein assay kit (Takara) respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Total protein was quantified using the TAKARA BCA Protein Assay Kit (TAKARA Bio Inc., Japan). Equal amounts of protein were separated by SDS-PAGE on 10% gels ...
-
bioRxiv - Cell Biology 2020Quote: ... putative miR-31-5p binding sequences were deleted in the plasmid DNA using PrimeSTAR Mutagenesis Basal Kit (TaKaRa Bio, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The Bradford protein assay kit was purchased from Takara Bio (Shiga ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Immunology 2021Quote: ... and the protein concentration was measured by BCA protein assay kit (TaKaRa, Dalian, China, cat#T9300A) as previous described(Ma et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein concentration was found to be 0.9 µg/µl using BCA Protein Assay Kit (TaKaRa).
-
bioRxiv - Physiology 2022Quote: ... Obtained luminescence was normalized to total protein concentration measured by BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...