Labshake search
Citations for Takara Bio :
1 - 50 of 1084 citations for Contactin Associated Protein Like 3 CNTNAP3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Full-length and truncated Cntn1 was PCR amplified from rat contactin-myc 34 and ligated together using an In-Fusion Snap Assembly Master Mix (Takara). All DNA constructs were verified by sequencing (Genewiz and plasmidsaurus).
-
bioRxiv - Evolutionary Biology 2022Quote: ... The recombinant Irg1-like protein was enriched using cobalt TALON Metal Affinity Resin (Takara Bio #635501) with gentle shaking for 1 hour at 4 ℃ and washed twice by centrifugation for 3 minutes at 3500 rpm at 4 ℃ and resuspension in the washing buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... magnanima was assessed by PCR amplifying a cifB-like gene (Extended Data Table 3) in the WOwHm-t76 region with the Emerald Amp Max Master mix (TaKaRa) at 94°C for 3 min ...
-
bioRxiv - Plant Biology 2020Quote: ... All of the other genes encoding candidate RBOHD-associated proteins were cloned into epiGreenB5 by the same strategy using an In-Fusion HD Cloning Kit (Clontech, USA). To generate epiGreenB-pPB1CP::PB1CP-3-eGFP for transient expression in N ...
-
bioRxiv - Microbiology 2023Quote: The open reading frames of 19 LD-associated proteins were amplified from RIB40 genomic DNA with PrimeSTAR® HS DNA Polymerase (TaKaRa, Otsu, Japan) for high-fidelity PCR ...
-
bioRxiv - Neuroscience 2020Quote: Adeno-associated viruses were made in AAV-Pro HEK293T cells (Takara Bio) by co-transfecting pAAV-GFP or pAAV-GFP-Zdhhc14sh#1 with pAAV2 (pACG2)-RC triple mutant (Y444 ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: For testing protein-protein interactions Matchmaker™ GAL4 Two-Hybrid System 3 was used according to the manufacturer’s instructions (Clontech). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus (AAV) cell-lysates were produced using the AAVpro Purification Kit (All Serotypes) (Takara) with slight modifications ...
-
bioRxiv - Physiology 2022Quote: ... The insulin-like growth factor 1 (IGF1) coding sequence was PCR amplified (CloneAmp, Takara Bio; Cat. No. 639298) from cDNA generated from a rat gastrocnemius muscle ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Neuroscience 2023Quote: ... Constructs containing point-mutated ARE-like sequences were prepared using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Shiga, Japan). Because an ARE half-site can function alone to confer androgen inducibility (Pihlajamaa et al. ...
-
bioRxiv - Plant Biology 2019Quote: The full-length cDNA of NaERF2-like with two HA flags was cloned into pCAMBIA1301 vector after 35S promoter via in-fusion technique (Clontech). N ...
-
bioRxiv - Molecular Biology 2023Quote: ... flanking the site of alterations (HDE-like motifs) were amplified from the genomic DNA using CloneAmp HiFi PCR Premix (Clontech), A-tailed with DreamTaq DNA polymerase and ligated into pGEM-T Easy vector ...
-
bioRxiv - Plant Biology 2020Quote: ... YFP-CESA6 protein was detected using anti-GFP antibody (Takara, catalog # 632381) and SEC12 was detected using anti-SEC12 antibody (Bar-Peled and Raikhel ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech ...
-
bioRxiv - Biophysics 2023Quote: ... Proteins were purified via immobilized metal affinity chromatography (IMAC) with TALON metal affinity cobalt resin and its associated buffer set (Takara), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Immunology 2021Quote: ... Additional to the NF-κB binding motifs NF-κB response element and a TATA-like sequence from pNFκB-Luc vector (Clontech Cat. No. 631904) were added to the Firefly luciferase gene and introduced into pCDH-CMV-EF1-Puro.
-
bioRxiv - Developmental Biology 2021Quote: ... the adeno-associated virus pseudotype 6 (AAV6) expression vector encoding ARP5 was constructed using AAVpro Helper Free System (AAV6) (TAKARA BIO). Finally ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Cell Biology 2021Quote: ... For iPSC-O differentiation to hepatocyte-like cells (HLC-O): Hepatic differentiation of iPSC-O was performed by Cellartis Hepatocyte Differentiation Kit (Y30050, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... Each half-site of the responsible ERE-like sequence was mutated into a HindIII recognition site using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Shiga, Japan). Transcriptional activity assays with these constructs were done as described above ...
-
bioRxiv - Biochemistry 2021Quote: ... monoclonal antibody for green fluorescent protein (JL-8; Takara Bio, Kusatsu, Japan; recognizes VC), rabbit anti-GFP (D5.1 Cell Signaling Technology 2956S ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech, dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP fusion proteins were revealed with mouse monoclonal antibody anti-GFP (JL-8, Clontech) used at 1/2000 dilution ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... Protein bands were detected by Western blot using a commercial 6xHis monoclonal antibody (631212, Clontech) and a goat anti-mouse IgG (H + L)-HRP conjugate (1706516 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal loading of the GFP tagged E2F1 proteins was determined by the GFP antibody (Clontech, lot. 1404005; 1:2000) the secondary antibody anti-rabbit HRP (Na934v ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...