Labshake search
Citations for Takara Bio :
1 - 50 of 386 citations for Caspase 9 CASP9 Antibody Pair since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... under high mutation rate conditions (9-16 mutations per kilobase pair) and subcloned into the pN1 vector (Clontech). Obtained gene libraries in expression vectors were electroporated into NEB10-β E.coli host cells (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 9 µl anti-c-Myc Monoclonal antibody (Clontech/Takara) were added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 9 µl anti-c-Myc Monoclonal antibody (Clontech/Takara) were added to each sample ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primer pairs were synthesized by TaKaRa and displayed in Table EV3.
-
bioRxiv - Molecular Biology 2022Quote: ... and Random Primer (nonadeoxyribonucleotide mix: pd(N)9) (TaKaRa) from the total RNA of Ophiocordyceps sp ...
-
bioRxiv - Genetics 2019Quote: ... Pairs of plasmids were transformed into strain Y187 (Clontech, Mountain View, CA, USA) and liquid β-galactosidase assays were performed using an OMEGASTAR plate reader (BMG Labtech ...
-
bioRxiv - Immunology 2019Quote: ... Multiplexed pair-end libraries 50nt in length were obtained using Nextera XT kit (Clontech). Sequencing was performed in a single batch with Illumina HiSeq 2500 using an average depth of 15 million reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9-15 cycles of PCR amplification were performed with Extaq (Takara). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9-15 cycles of PCR amplification were performed with Extaq (Takara). Finally ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and wild type etoll-9 was cloned in pGBKT7-BD vector (Clontech). Each mutant etoll-AD was transformed in Y187 strain followed by selection on synthetic defined (SD ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara, Japan). The AAV solution was concentrated to the optimal volume by centrifugation using an Amicon Ultra-4 100k centrifugal filter unit (Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting bait and prey vectors were co-transformed in pairs into yeast strain Gold yeast (Clontech). The SD-Leu-Trp transformants were isolated and assayed for growth on SD-Leu-Trp-His-Ade medium [61].
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was performed for 8-9 cycles using PrimeSTAR GXL Polymerase (Takara) at an annealing temperature of 60°C ...
-
bioRxiv - Genomics 2022Quote: ... rAAV-9 serotype virons were produced by transfecting AAVpro 293T cell (Takara, 6322723) with pCMV-sadCas9-KRAB (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara, Siga, Japan). The AAV solution was concentrated to the optimal volume by centrifugation using an Amicon Ultra-4 100k centrifugal filter unit (Millipore) ...
-
bioRxiv - Bioengineering 2024Quote: ... lentivirus targeting mCherry to the cell membrane (Takara, 0026VCT, rLV.EF1.mCherry-Mem-9) was used according to manufactures recommendation ...
-
bioRxiv - Genomics 2021Quote: ... primer pairs specific for each investigated enhancer were used for PCR amplification with the EpiTaq HS polymerase (TaKaRa). Finally ...
-
bioRxiv - Biochemistry 2021Quote: Nucleosomes with the 145 base-pair DNA (200 ng each) were mixed with 0.01 unit/μL micrococcal nuclease (MNase; Takara) and incubated at 37°C for 0 ...
-
bioRxiv - Microbiology 2022Quote: ... Then 50 nl of primer pair solution mixed with 1X SmartChip TB Green Gene Expression Master Mix (Takara Bio) were loaded onto the SmartChip ...
-
bioRxiv - Microbiology 2023Quote: ... using Psme1Sal1-F/Psme1BamHI-R primer pairs (Table S4) and cloned as a Sal1/BamH1 fragment into pEGFPC1 (Clontech). For production of GST- and His6-Myc-fusion proteins ...
-
bioRxiv - Molecular Biology 2020Quote: ... Six hundred thirty nanograms of total RNA was annealed to random 9-mer primers (TaKaRa) and reverse-transcribed using ProtoScript II (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2019Quote: ... the MS2 binding sites were amplified with primer pair 1 (Supplementary File 1: Table S4) and cloned into pEGFP-C1 (Clontech) as EcoRI/BamHI fragment ...
-
bioRxiv - Systems Biology 2022Quote: ... Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies) carrying 16-base pair overhangs at the 5’ and 3’ ends to facilitate in-fusion cloning (Clontech) into pET expression vectors (EMD MIllipore).
-
bioRxiv - Genetics 2020Quote: ... and complementary primer pairs (sequences available on request) was used to generate TMEM127 variants in the pEGFP-C2 (Clontech Laboratories) and pCMV6-XL5 (Origene ...
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Microbiology 2020Quote: ... residues 1-188 and residues 189-291 of PipB were amplified from SL1344 genomic DNA with the following oligonucleotide pairs and ligated into pGAD424 (Clontech): pGAD-PipB-1F and pGAD-PipB-291R ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed using first-strand cDNA and a primer pair designed for target genes using the SYBR Premix Ex Taq Perfect Real Time Kit Tli RNAaseH Plus (TAKARA) and Thermal Cycler Dice Real Time System (Model TP800 ...
-
bioRxiv - Biochemistry 2023Quote: The gene encoding XccOpgD (GenBank: AAM43366.1) was amplified by PCR with the primer pair shown in Supplementary Table 1 using PrimeSTAR Max (Takara Bio) and a genomic DNA of X ...
-
bioRxiv - Microbiology 2024Quote: Each individual SARS-CoV-2 fragment was amplified from their respective plasmids using an exclusive pair of primers (Supplementary Table 2) and high-fidelity PrimeSTAR GXL DNA polymerase (Takara), followed by gel isolation with NucleoSpin Gel and PCR Clean-up (Macherey-Nagel ...
-
bioRxiv - Genomics 2020Quote: ... Each sample was PCR amplified for 9 cycles using HS LA Taq (Takara, Mountain View, CA) and cleaned with 0.7X AMPure beads to remove small fragments and excess reagents (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: ... H2B-mCherry organoids were infected with LV.EF1.AcGFP1-Mem-9 lentivirus particle (Clontech, Takara Bio USA). For the H2B-miRFP670 line ...
-
bioRxiv - Cell Biology 2022Quote: ... H2B-mCherry organoids were infected with LV.EF1.AcGFP1-Mem-9 lentivirus particle (Clontech, Takara Bio USA). For the H2B-miRFP670 line ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pair of gene specific primers TaAFR-F and TaAFR-R (S1 Table) and Tks Gflex™ DNA Polymerase (TaKaRa, Japan) were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: ... Then PCR application using specific primer pairs (Supplemental Table 2) designed for H7N9 virus and Takara One-step RT-PCR kit (Takara, China) segment by segment ...
-
bioRxiv - Immunology 2024Quote: ... Two-step PCR to amplify gag or pol region was performed with eight different primer pairs (Supplemental Table 1) and Ex-Taq (TaKaRa-Bio) as described previously (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were then co-transfected with 150 ng of the pBiFC-HA-Casp2(S384E)-VC155 and pBiFC-HA-Casp2(S384E)-VN173 (mouse caspase-2) for BiFC and 10 ng of pDsRed-Mito (Clontech) as a transfection reporter plasmid ...
-
bioRxiv - Plant Biology 2020Quote: ... while specific AD and BD recombinant plasmid pairs were used to co-transform yeast strain AH109 cells according to the Yeast Protocols Handbook (Takara, Dalian, China).
-
bioRxiv - Microbiology 2020Quote: ... The erythromycin resistance gene was amplified from plasmid pMG36e using primer pair EmrF/EmrR and then connected with linearized pMD19-GmloxP using In-Fusion HD Enzyme (Takara, Daliang, China), generating the plasmid pMD19-EmrloxP ...
-
bioRxiv - Plant Biology 2022Quote: ... the entire ELF3 genomic sequence present in three HIF pairs was amplified using Ex Taq DNA Polymerase (Takara Bio, Kusatu, Shiga, Japan) and 1186 bp of promoter sequence upstream of the ELF3 start codon in HIF pair 10 was amplified using ALLin™ RPH Polymerase (highQu GmbH ...
-
bioRxiv - Microbiology 2020Quote: ... The devH coding region amplified by PCR using the primer pair NHisdevH-F1 and NHisdevH-R1 was cloned between the NdeI and SalI sites of the expression vector pColdProS2 (Takara Bio, Shiga, Japan) to construct pCProS2DevH ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... which was modified to obtain a CFP reporter cell line (rLV.EF1.AmCyan1-9 [0039VCT] Clontech, Takara Bio Europe). The LX2 cell line was maintained in DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... which was modified to obtain a CFP reporter cell line (rLV.EF1.AmCyan1-9 [0039VCT] Clontech, Takara Bio Europe). The LX2 cell line was maintained in DMEM ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was performed for 8-9 cycles using high-fidelity polymerase (LA-Taq or PrimeSTAR GXL, Takara) at an annealing temperature of 60℃ ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... High-quality RNA (10 ng, RIN>9) was used to produce cDNA libraries using SmartSeq v4 (Clontech, 634888). cDNA was prepared into sequencing libraries using 150 pg of full-length cDNA amplicons with the Illumina® Nextera XT DNA Library Preparation Kit with dual index barcodes ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Genetics 2023Quote: ... electrophoresis was performed using 9 μL of the PCR products on a 2% agarose gel (Takara Bio, Japan) at 100 V ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts of the target genes were amplified with the corresponding primer pairs (S2 Table) and quantified with SuperReal PreMix Plus (SYBR Green) (Takara biomedical technology, Beijing, China), using the 18S rRNA was used as control ...
-
bioRxiv - Microbiology 2020Quote: ... thlaspeos tissue was resuspended in 9 ml protoplasting buffer supplemented with 10 mg/ml Yatalase (Takara Bio, Kusatsu, Japan) and 20 mg/ml Glucanex (Sigma-Aldrich ...