Labshake search
Citations for Takara Bio :
1 - 50 of 63 citations for Argininosuccinic Acid Barium Salt 2H2O Arginine 13C6 99%; 15N4 99% 90%+ Cp since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex ...
-
bioRxiv - Cancer Biology 2023Quote: ... water-soluble tetrazolium salt (WST-1) (Takara, India). The western diet was customized and purchased from Research Diets Inc ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and 90 μl of DNase I (1 U/μl) (TAKARA, Japan). The suspension was thoroughly re-suspended ...
-
bioRxiv - Cancer Biology 2023Quote: ... monosodium salt (WST-1) (Takara BioInc, Clontech Laboratories, Inc.). 4 × 103 cells/ml was cultured in 5 replicates in 96-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... monosodium salt (WST-1) (Takara BioInc, Clontech Laboratories, Inc.). 4 × 103 cells/ml was cultured in 5 replicates in 96-well plates ...
-
bioRxiv - Microbiology 2020Quote: ... in buffer solution (10xLow salt buffer, Takara Bio Co. Ltd.) and 5 folds dilution by de-ionized water ...
-
bioRxiv - Molecular Biology 2024Quote: ... The tetrazolium salts from Premix WST-1 Cell Proliferation Assay System (TAKARA) are cleaved by mitochondrial dehydrogenase in viable cells to produce formazan dye ...
-
bioRxiv - Plant Biology 2022Quote: ... purified with a high-salt solution for precipitation (Takara Bio Inc., Ohtsu, Japan) and reverse transcribed with ReverTra Ace (Toyobo) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized for 90 minutes at 42°C with 170 U SMARTscribe reverse transcriptase (Takara, Clontech) in a total volume of 20μl containing 1.7U/μl RNasin (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized for 90 minutes at 42°C with 170 U SMARTscribe reverse transcriptase (Takara, Clontech) in a total volume of 20μl containing 1.7U/μl RNasin (Promega) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA extraction with TRIZOL reagent and a high salt solution for precipitation (plant) (Takara Bio, Japan) was conducted according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Microbiology 2020Quote: ... media (0.67% yeast nitrogen base, 0.5% glucose, 0.01% adenine hemisulfate salt) supplemented with -Leu DO supplement (Clontech) (SD-Leu ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant protein were purified to >90% electrophoretic purity by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with imidazole as described previously24 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 × 104 SH-SY5Y cells in 90 µL of growth media containing no antibiotics were plated in opaque TC-treated 96-well plates containing Xfect (Clontech)/DNA transfection complexes ...
-
bioRxiv - Immunology 2023Quote: ... cells were harvested and resuspended in retroviral supernatant and centrifuged for 90 minutes at 1000g at 32°C on retronectin (TaKaRa) coated plates.
-
bioRxiv - Cell Biology 2024Quote: ... in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90%) Lenti-X 293T cells (Clontech) grown on a 10-cm tissue culture dish ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The decanted soluble extract was adjusted to a volume of 90 mL with lysis buffer and incubated with 10 mL TALON cobalt resin (Takara, Shiga, Japan) for 1 h at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... seedlings were subjected to 200 mM salt stress for 24 h and total RNA was isolated by RNAiso plus (Takara, China). Subsequently ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 mM maleic acid buffer pH 5.5) containing 100 mg Yatalase (Takara) and 100 mg Lysing Enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... Gaillardia × grandiflora ‘Arizona Apricot’ and Antirrhinum majus using Sepasol RNA I Super G (Nacalai Tesque) and purified with a high-salt solution for precipitation (Takara Bio Inc.). A five-micro gram of total RNA was used for the gel blot analysis ...
-
bioRxiv - Cell Biology 2020Quote: ... target proteins were purified from cell lysate by Ni-iminodiacetic acid affinity chromatography (Clontech). However ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentration was determined by bicinchoninic acid assay using bovine serum albumin (TaKaRa Bio) as the reference standard ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Microbiology 2019Quote: ... and N-glycolylneuraminic acid (NeuGc) released were labeled with 1,2-diamino-4,5-methylenedioxybenzene (DMB) using a commercial kit (Takara, Shiga, Japan). The DMB-labeled sialic acids were analyzed by HPLC equipped with a TSK-ODS80Ts column (Tosoh ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... For binding studies the 6xHis tag were removed from some Fabs by treatment with PreScission protease (MolBioTech; ThermoScientific) and the protein repurified on cobalt-nitrilotriacetic acid (Co-NTA) agarose (Clontech) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...