Labshake search
Citations for Takara Bio :
1 - 50 of 1480 citations for Alpha 1 B Glycoprotein A1BG Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... AP20187 (B/B) compound (Takara Bioscience) was injected into the dorsal aorta through a small window made in the ventral egg ...
-
bioRxiv - Biophysics 2022Quote: ... B/B homodimeriser (AP20187, Takara Bio), dibenzocyclooctyne-PEG4-maleimide (760676 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... B/B dimerizer (AP20187 ligand; TaKaRa 635058) was added to a final concentration of 500 nM in the well ...
-
bioRxiv - Immunology 2022Quote: ... B/B homodimerizer (Takara Bio, Cat#635058), b-estradiol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 nM B/B Homodimerizer (Takara, #635058) was also added ...
-
bioRxiv - Neuroscience 2023Quote: B/B homodimerizer was purchased from Takara USA lnc ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
bioRxiv - Pathology 2020Quote: AP21087 ((B/B homodimerizer, Takara Bio, CA, USA) was administered by intra-peritoneal (ip ...
-
bioRxiv - Cell Biology 2019Quote: ... AP20187 (B/B Homodimerizer) was purchased from Takara. The recombinant Anti-M1 Spastin rabbit monoclonal antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 500 nM of the B/B dimerizer (TaKaRa 635058) was added 2 hours before the start of the assay (or an Ethanol vehicle control was added) ...
-
bioRxiv - Immunology 2019Quote: ... B/B Homodimerizer (Takara, 635059, equivalent to AP-20187), disuccinimidyl suberate (DSS ...
-
bioRxiv - Neuroscience 2022Quote: ... AP20187 (B/B) (Clontech, Saint-Germain-en-Laye France) was added 4 h post-transfection overnight.
-
bioRxiv - Developmental Biology 2020Quote: ... 1.0 μl of 25mM B/B (in DMSO) (AP20187, Takara) was added to 50ul of PGCs (3,000 PGCs/μl ...
-
bioRxiv - Genetics 2020Quote: ... 1.0 ul of 25mM B/B (in DMSO) (Takara Bio) was added to 50ul PGC suspension before injection and subsequently 50 μl 300ul P/S (containing 30ul of 0.5mM B/B drug ...
-
bioRxiv - Biochemistry 2021Quote: ... After 16 hours of incubation with B/B homodimerizer (Takara Bio, 635059) at various concentrations ...
-
bioRxiv - Immunology 2022Quote: ... cells were stimulated with indicated concentrations of B/B homodimerizer (Takara Bio) for 15 h ...
-
bioRxiv - Neuroscience 2023Quote: ... the designed drug AP20187 (AP; B/B Homodimerizer purchased from Takara #635058) was first prepared according to manufacturer’s directions in 100% ethanol ...
-
bioRxiv - Microbiology 2019Quote: ... and hygromycin B (Clontech) were added to the medium ...
-
bioRxiv - Cell Biology 2021Quote: ... Aggregates were formed by addition of 500nM rapalog2 (Takara, B/B homodimerizer #635059) for 1 h ...
-
bioRxiv - Biophysics 2023Quote: ... Pyroptosis was induced by addition of 500nM B/B-Homodimerizer (Takara Bio, AP20187) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were exchanged with fresh media containing B/B homodimerizer (500nM) (Takara Bio, #635059) and/or Baf-A1 (100nM ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Microbiology 2019Quote: The dual-luciferase assay using an NF-□B–dependent firefly luciferase (pNF-□B-Luc; Clontech) and a Renilla luciferase driven by the thymidine kinase promoter (pRLTK ...
-
bioRxiv - Microbiology 2022Quote: ... X-alpha-Gal (X-α-gal) and aureobasidin A (AbA) were obtained from TaKaRa. Plasmids ...
-
bioRxiv - Microbiology 2021Quote: ... Complete nucleoprotein and glycoprotein genes were amplified using Takara long amplicon Taq polymerase with GC buffers (RR02AG Takara Bio USA, Mountain View, CA, USA) using the primers indicated in Table 1 after cDNA synthesis using random hexamer primers and Roche AMV reverse transcriptase (10109118001 Roche ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Synthetic Biology 2023Quote: ... T cells were incubated at 3×104 cells/well in 96-well U bottom plates for 24 hours in T cell media containing 50 IU/mL rhIL-2 and varying concentrations of AP20187 (B/B homodimerizer, Takara, 635058). After 24 hours ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP monoclonal antibody (Takara, # 632375; 1:2,000), Bip2 antibody (Agrisera ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP antibody (Clontech, rabbit, 1:2000), anti-Ago1 antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody (cat # 632380, 1: 2,000, Clontech) and horseradish peroxidase (HRP)-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Genomics 2023Quote: ... Antibody list: FOXG1 (rabbit, 1:200, Takara) and PAX6 (mouse ...
-
bioRxiv - Molecular Biology 2021Quote: ... cultivated in mTESR1 and grown 48hrs before functionality of the suicide gene was assessed by adding the chemical inducer of dimerization (CID) (AP20187, B/B Homodimerizer, Clontech Laboratories, Inc), or AP1903 ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... 86% of 2% Tween 20 in deionized Water) or AP20187 (B/B homodimerizer, Clontech; 10 mg of AP20187 per kg body mass) twice weekly at the age of 20 months for a total of 4 months (old mice were sacrificed at 24 months of age) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 12 µg RetroNectin solution (TaKaRa Biomedicals, cat# T100A/B) in PBS was added to each well of untreated 6-well plates (Greiner ...
-
bioRxiv - Cancer Biology 2019Quote: ... transfected cells were treated with 200 µg/mL hygromycin B (Nacalai Tesque, Kyoto, Japan) or 1 µg/mL puromycin (Clontech) for the selection of stably transfected cells.
-
bioRxiv - Genetics 2021Quote: ... This plasmid was further used to generate backbone structure containing fust-1 promoter and mRFP, to which cDNAs of FUST-1 isoforms (isoform a, isoform b, and ΔN) were inserted by In-Fusion (Takara). The mRFP fused FUST-1 cDNA plasmids were used to generate cDNA only plasmids for splicing reporter rescue by removing the mRFP sequences using In-Fusion (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Immunology 2019Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-DsRed antibodies (1:3000, Takara, 632496). Sections were washed three times in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used: DsRed (Rabbit, 1:2000, Clontech), VGLUT1 (Guinea Pig ...
-
bioRxiv - Immunology 2022Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), rabbit anti-Lcp1 (1:1000) ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% normal donkey serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6xHN Polyclonal Antibody (1:2000, Takara, CA, USA) at 4°C for overnight ...