Labshake search
Citations for Takara Bio :
1 - 50 of 901 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was produced using an Adenovirus Dual Expression Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Hexon staining was performed using the Adeno X Rapid Titer Kit (Takara Bio Europe ...
-
bioRxiv - Microbiology 2020Quote: ... Ad5 stocks were tittered by detection of the Ad hexon protein using Adeno-X™ Rapid Titer Kit (Cat. No. 632250, Takara, Clontech). The Ad5 CPE was dose-dependent ...
-
bioRxiv - Microbiology 2020Quote: ... Ad5 stocks were tittered by detection of the Ad hexon protein using Adeno-X™ Rapid Titer Kit (Cat. No. 632250, Takara, Clontech). The Ad5 CPE was dose-dependent ...
-
bioRxiv - Cell Biology 2020Quote: ... Adenovirus expressing human SPARC was constructed using Adeno-X expression system (Clontech) as described before 30,31 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...
-
bioRxiv - Molecular Biology 2020Quote: Adenovirus vectors were generated with the Adeno-X Adenoviral System 3 following manufacturer’s instructions (Takara, #632267). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... The titer of adenovirus was examined using an Adeno-XTM Rapid Titer Kit (Takara Bio USA) and determined to be 3.4 × 1011 ifu/ml ...
-
bioRxiv - Physiology 2021Quote: ... Adenovirus was generated in HEK293A cells and titered using the Adeno-X Rapid Titer Kit (Takara Bio). For differentiation ...
-
bioRxiv - Biochemistry 2024Quote: The Upf1-HD-His6 wild-type protein was first purified on a TALONTM resin (Clontech) equilibrated with buffer A200 ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant adenovirus vaccines were produced using the Adeno-X™ Adenoviral System 3 according to the manufacturer’s manual (Takara Korea Biomedical Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Physiology 2023Quote: ... The adenovirus titer in plaque-forming units (PFU) was determined using a Adeno-X Rapid Titer kit (Clontech, Palo Alto, CA).
-
bioRxiv - Cell Biology 2023Quote: ... procollagen type I (Takara #MK101), fibronectin (Takara #MK115) ...
-
bioRxiv - Cell Biology 2019Quote: ... wild-type SAF-A was cloned into pEGFP-N1 (Clontech) and confirmed by DNA sequencing ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Developmental Biology 2020Quote: ... subsequently placed in a line in the electrode gap filled with 5 μl the mixture of 120 ng/μl Cas9 protein (TaKaRa, Japan), 300 ng/μl tracerRNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and wild type etoll-9 was cloned in pGBKT7-BD vector (Clontech). Each mutant etoll-AD was transformed in Y187 strain followed by selection on synthetic defined (SD ...
-
bioRxiv - Genomics 2019Quote: ... Wild-type sequences were generated by PCR using human genomic DNA (Clontech) as a template ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plasma Gla-type osteocalcin was analyzed by enzyme immunoassay (#MK111, Takara, Japan). The absorbance was read at 450 nm using a microplate reader (Bio-Tek ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using BCA Protein Assay Kit (TaKaRa). The samples were subjected to SDS-PAGE ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... replication-defective adenoviral vectors expressing dominant wild type FoxO3a were designed and purchased from TaKaRa Biotechnology (Dalian ...
-
bioRxiv - Cancer Biology 2021Quote: ... The wilde-type (WT) hTERT-immortalized retinal pigment epithelium (hTERT-RPE1, Clontech, Palo Alto, CA) and RPE1–MYCN-ER were cultured in DMEM/F-12 HEPES ...
-
bioRxiv - Cell Biology 2022Quote: Full length wild type human RORβ (NM_006914.3) was subcloned into the pLPCX retroviral vector (Clontech) using XhoI and NotI restriction enzymes (NEB ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Neuroscience 2021Quote: ... Alix-YFP was obtained by subcloning wild type Alix cDNA into a pEYFP-N1 vector (Clontech). GFP-flag-Alix (GFP-Alix ...
-
bioRxiv - Genetics 2022Quote: Full length wild-type or mutant BRC-1 sequences were cloned into plasmid pBridge (Takara Bio), transformed into yeast strain Y2HGold (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: Procollagen Type 1 C-peptide (PIP) was measured according to the manufacturer’s instructions (Takara, Shiga, Japan). For evaluation of PIP ...
-
bioRxiv - Plant Biology 2024Quote: ... The SKI2 cDNA sequence was amplified from wild type cDNA using CloneAmp HiFi PCR Premix (Takara) and cloned into the pPZP212 binary vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... based on the manufacturer’s recommendation with wild type MST2 or MST2_delEDG subcloned in pLVX_TetOne-Puro (Clontech # 631849). Cells were cultured in presence of Doxycycline (Dox ...