Labshake search
Citations for Takara Bio :
1 - 50 of 2137 citations for 7 Fluoro 6 amino 2H 1 4 benzoxazin 3 4H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Developmental Biology 2022Quote: ... Co-IPs were carried out by incubating the samples with 30 μL of protein A agarose bead slurry for 4h at 4°C in a rotating wheel and with anti-mCherry (Takara 632496) of 1:1000 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of PrimeScript One Step Enzyme Mix (TaKaRa), 10 μL of 2× One Step RT-PCR buffer (TaKaRa) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Overnight primary antibody incubation was done at 4°C with one or more of the following antibodies in blocking buffer: rabbit anti-DsRed (Takara Bio, 632496, 1:500), goat anti-mCherry (Sicgen ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Synthetic Biology 2022Quote: Retroviral/lentiviral transductions were performed on days 3 and 4 post activation on retronectin (Takara) coated non-tissue culture treated plates ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pHISi-1 vector was provided by the Matchmaker one-hybrid kit (Clontech, CA). The 40 bp promoter sequence was originally cloned from the maize C1 gene promoter (22) ...
-
bioRxiv - Plant Biology 2022Quote: Yeast one-hybrid assays were performed using the Matchmaker Yeast One-Hybrid System (Clontech). The DNA fragment 1,000 bp upstream of the start codon ATG of DDRM2 was cloned into pHis2.1 vector and SOG1 was cloned into the pGADT7 vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Bioengineering 2021Quote: ... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × 106 PBMCs were plated on retronectin coated 6-well plates (Takara Clonetech) with retroviral vectors and centrifuged at 1,000 × g for 40 min ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Plant Biology 2023Quote: Yeast one-hybrid assays were performed using the Matchmaker Gold Yeast One-Hybrid System Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Biochemistry 2020Quote: ... U-[15N,12C,2H]-labelled REC3 domain was overexpressed in BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340) in M9 medium in 2H2O containing 2 g l−1 2H12C glucose (Sigma #552003 ...
-
bioRxiv - Plant Biology 2021Quote: ... yeast one-hybrid assays were performed as the manual of Matchmaker Gold Yeast One-Hybrid System (Clontech). The coding sequence of BnaA03.WRKY28 was cloned into pGADT7 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... One-step qPCR was performed using One Step PrimeScript™ III RT-qPCR Mix (Takara, Kusatsu, Japan) with primers as follows ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were assembled into pEMC vector one-by-one using in-fusion HD cloning kit (Takara), generating pEMC-eGFP-MBaMV ...
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLVX-Tet-One-Puro vector (Clontech, #631847), encoding for an engineered Tet activator and the corresponding inducible promoter ...
-
bioRxiv - Plant Biology 2019Quote: The Matchmaker yeast-one-hybrid system (Clontech) was used to test the binding of NaERF2-like and the NaEAS12 promoter in vitro according to the user manual ...
-
bioRxiv - Microbiology 2023Quote: ... expression plasmid pLVX Tet-One Puro (Clontech) was modified to have a MCS at the 3’end of Tet responsive promoter TRE3GS using EcoR1/BamH1 cut sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Cancer Biology 2023Quote: ... 150,000 cells were seeded in 6-well plates 1 day before transfection with 1 μg pp53-TA-Luc vector (Clontech) and 0.015 μg pRL-CMV-Renilla (Promega ...
-
bioRxiv - Systems Biology 2019Quote: MCF-7 Tet-On cells were purchased from Clontech and maintained as previously described (Liu et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 × 106 HEK293T cells were transfected with 7 μg of Env expressor and 1 μg of a green fluorescent protein (GFP) expressor (pIRES2-EGFP; Clontech) with the calcium phosphate method ...
-
bioRxiv - Biophysics 2022Quote: ... and slowly shaken with all-trans-retinal (added to a final concentration of 25 μM) in the dark at room temperature for 3–4 h in the presence of 0.5 % of Westase (Takara Bio, Inc.) to digest the cell wall ...
-
bioRxiv - Neuroscience 2023Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Genomics 2020Quote: Yeast one-hybridization assay was performed using the Matchmaker® Gold Yeast One-Hybrid System (Clontech, Palo Alto, CA, USA). The promoter sequence (upstream 2kb from the start codon ...
-
bioRxiv - Cell Biology 2021Quote: ... One microgramme of total RNA was reverse-transcribed using a One Step PrimeScript™ RT-PCR Kit (Takara, Liaoning, China) with a thermocycler ...
-
bioRxiv - Molecular Biology 2021Quote: ... One-step PrimeScript miRNA cDNA Synthesis Kit (Takara) was applied for reverse transcription ...
-
bioRxiv - Microbiology 2020Quote: ... One-Step PrimeScript RT-PCR Kit (Takara, RR064) was utilized for qRT-PCR (probe ...
-
bioRxiv - Genetics 2023Quote: ... Then One-step PrimeScript RT-PCR kit (Takara) was used to generate cDNA ...