Labshake search
Citations for Takara Bio :
1 - 50 of 813 citations for 7 Chloro N 3 chloro 4 fluorophenyl 6 nitro 4 quinazolinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Cell Biology 2024Quote: ... and human adult heart RNA (n=4 pooled, Cat #636583, Takara) were used for bulk RNA sequencing ...
-
bioRxiv - Synthetic Biology 2022Quote: Retroviral/lentiviral transductions were performed on days 3 and 4 post activation on retronectin (Takara) coated non-tissue culture treated plates ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Immunology 2023Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.6 μl of 100 μM random primer (N)6 (TaKaRa, Kusatsu, Japan), with RNase-free water added up to 20 μl ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 U RNAse inhibitor (Takara, 2313A), 10mM dNTPs (Thermo Scientific ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... and 4) TaKaRa LA Taq (TaKaRa RR042). For each library ...
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...
-
bioRxiv - Biophysics 2022Quote: ... and slowly shaken with all-trans-retinal (added to a final concentration of 25 μM) in the dark at room temperature for 3–4 h in the presence of 0.5 % of Westase (Takara Bio, Inc.) to digest the cell wall ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Neuroscience 2023Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Genomics 2020Quote: ... corresponding primers (Supplementary Table 3-4), Phanta Max Super-fidelity DNA Polymerase (Cat. No. P505-d1, Vazyme) or KOD plus (Cat. No. F0934K, Takara, Kyoto, Japan) with a touchdown cycling protocol that contains 30 cycles of 98 °C for 10 s ...
-
bioRxiv - Cell Biology 2021Quote: ... Sanger sequencing was performed after PCR amplification with appropriate primers (Fw#3 and Rv#4, S1 Table) and PrimeSTAR HS DNA Polymerase (Takara, Kyoto, Japan).
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Microbiology 2023Quote: ... After co-cultivation, the organoids were collected and resuspended in 4% paraformaldehyde (PFA, Servicebio, China) at 4℃ or RNAiso Plus (Takara, Japan) at -80℃ for further analysis ...
-
bioRxiv - Biophysics 2024Quote: ... for 35 min at 4°C and the supernatant was incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Purification Buffer and 10 column volumes of Purification Buffer with 10 mM imidazole before elution using Purification Buffer with 300 mM imidazole ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:4 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 2 and 10 column volumes of Membrane Buffer 2 with 20 mM imidazole before elution with Membrane Buffer 2 with 300 mM imidazole ...
-
bioRxiv - Molecular Biology 2020Quote: ... Aliquots of total RNA (1 μg) were reverse transcribed using pd(N)6 random primer (Takara Bio) and Moloney murine leukemia virus (M-MLV ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq DNA polymerase 4 units (Takara Inc., Dalian, China), and milli-Q water approximately 37 μL ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Genomics 2022Quote: ... 4 mL of lung tissue RNA (Takara Bio, 636524) at a final concentration of 500 pg per μl was used ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Biochemistry 2021Quote: ... then incubated at 4 °C in Lenti-X Concentrator (Clontech) for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Microbiology 2022Quote: ... expression was induced by addition of 4 ng/ml anhydrotetracycline (Clontech) at 4 hpi.
-
bioRxiv - Microbiology 2021Quote: ... 4 μl of 5X In-Fusion premix (Takara Bio, cat#638909), and milliQ water up to 20 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using 4 µL TransIT 293 (Takara, Shiga, Japan) and 100 µL OPTI-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 4 μg of pCMV-β-galactosidase (Clontech Laboratories, Inc., CA, USA) using electroporation according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 2.5 mM of each deoxyribose triphosphates (dNTPs) (TAKARA, Japan), and 1 μl of 10 mM of primers or TaqMan probes.
-
bioRxiv - Immunology 2022Quote: ... pmCherry-N’ (Clontech) between NheI and HindIII restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 °C for 45 min and the supernatants incubated with TALON beads (Clontech) pre-equlibrated with purification buffer at RT over night with overhead rotation followed by washing with wash buffer (8M urea ...
-
bioRxiv - Neuroscience 2019Quote: ... and concentrated using ultracentrifugation (26,000rpm/2hrs/4°C) or Lenti-X concentrator (Clontech) before being added to cell cultures ...
-
bioRxiv - Immunology 2021Quote: ... were coated overnight at 4°C with 20 μg/ml Retronectin (Takara T100B). Viral supernatant was spun for 90 minutes at 2,000g and 30°C onto the plated retronectin and half the supernatant volume removed carefully after spinning ...