Labshake search
Citations for Takara Bio :
1 - 50 of 335 citations for 7 1H Pteridinone 4 amino 6 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Bioengineering 2021Quote: ... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Systems Biology 2019Quote: MCF-7 Tet-On cells were purchased from Clontech and maintained as previously described (Liu et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% normal donkey serum) for 1h at room temperature followed by incubation in primary antibodies (rabbit anti Ds-red, Takara, cat# 632496 ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2-NTCP and Huh-7 cells with RNAi plus (TaKaRa, Japan) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: 7 μg of lentiviral vectors was mixed with Lenti-XTM packaging single shots (Clontech) in a final volume of 600μl for 15min before the transfection mix were added to 4 million of Lenti-X TM 293T cells seeded on a 10 cm2 tissue culture dish ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Immunology 2023Quote: ... the non-tissue culture 24-well plates were coated with 7 μg/ml RetroNectin (TAKARA) for 3 hours at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: HaCaT cells were treated with the E-cadherin-blocking antibody (SHE78-7, Takara, Shiga, Japan), PY-60 (Axon Medchem ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Microbiology 2021Quote: ... plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7) and PrimeSTAR GXL Polymerase (Takara, Japan). Cycling conditions were as follows ...
-
bioRxiv - Biophysics 2021Quote: ... The 7-kb band was excised and recycled using Agarose Gel DNA Extraction Kit (TaKaRa Bio). Concurrently ...
-
bioRxiv - Cell Biology 2022Quote: MCF-7 and T47D cells were harvested and total RNA was extracted with RNA Trizol (TAKARA) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...