Labshake search
Citations for Takara Bio :
1 - 50 of 507 citations for 7 3 methoxyphenyl 7 oxoheptanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Systems Biology 2019Quote: MCF-7 Tet-On cells were purchased from Clontech and maintained as previously described (Liu et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2-NTCP and Huh-7 cells with RNAi plus (TaKaRa, Japan) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: 7 μg of lentiviral vectors was mixed with Lenti-XTM packaging single shots (Clontech) in a final volume of 600μl for 15min before the transfection mix were added to 4 million of Lenti-X TM 293T cells seeded on a 10 cm2 tissue culture dish ...
-
bioRxiv - Immunology 2023Quote: ... the non-tissue culture 24-well plates were coated with 7 μg/ml RetroNectin (TAKARA) for 3 hours at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: HaCaT cells were treated with the E-cadherin-blocking antibody (SHE78-7, Takara, Shiga, Japan), PY-60 (Axon Medchem ...
-
bioRxiv - Microbiology 2021Quote: ... plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7) and PrimeSTAR GXL Polymerase (Takara, Japan). Cycling conditions were as follows ...
-
bioRxiv - Biophysics 2021Quote: ... The 7-kb band was excised and recycled using Agarose Gel DNA Extraction Kit (TaKaRa Bio). Concurrently ...
-
bioRxiv - Cell Biology 2022Quote: MCF-7 and T47D cells were harvested and total RNA was extracted with RNA Trizol (TAKARA) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... A2058 and MDST8 as previously described (7) with small changes for adherent cell lines omitting RetroNectin (Clontech). LCL-1 was transduced with single minigenes ...
-
bioRxiv - Neuroscience 2023Quote: Neurons were transfected at day in vitro (DIV) 7 using CalPhos Mammalian Transfection Kit (Takara Bio, 631312). Transfection solution was prepared by adding 1.5 µg DNA per construct (3 µg in total ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Biochemistry 2022Quote: shTnsB mutants (Fig. 7) were generated in the pHelper vector using the In-Fusion cloning kit from Takara and primers containing the desired point mutations ...
-
bioRxiv - Cell Biology 2024Quote: ... 7 μg of lentiviral vectors was mixed with a Lenti-X packaging (VSV-G) single shots tube (Clontech) in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90% ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Immunology 2019Quote: ... Rab 5 and Rab 7 cDNA (a gift of M. Sandor) and human CD81 cDNA (Open Biosystems) were cloned into pmCherry-N1 vector (Clontech). Raji/DC-SIGN cells were electroporated with 1 µg of indicated plasmid using the Eppendorf Multiporator in iso-osmolar electroporation buffer using a 90 µs ...
-
bioRxiv - Biochemistry 2022Quote: ... 127926 and 127924). shTnsB mutants (Fig. 7) were generated in the pHelper vector using the In-Fusion cloning kit from Takara and primers containing the desired point mutations ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral transduction of murine alveolar macrophages was performed for 7 days in the presence of 5 μg/cm2 RetroNectin (Takara). Stable gene expression was confirmed by GFP signals using a BZ-X710 (KEYENCE ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 × 106 HEK293T cells were transfected with 7 μg of Env expressor and 1 μg of a green fluorescent protein (GFP) expressor (pIRES2-EGFP; Clontech) with the calcium phosphate method ...
-
bioRxiv - Molecular Biology 2022Quote: ... ceranae-inoculated workers’ midguts at 7 dpi and 10 dpi were respectively isolated using RNA Extraction Kit (TaKaRa company, Dalian, China). cDNA was synthesized through reverse transcription with oligo dT primer and used as templates for qPCR assay ...
-
bioRxiv - Molecular Biology 2019Quote: The MCF-7 cell line (ATCC, Manassas, VA, USA) was stably transfected with peGFP-C1 vector (Clontech, Mountain View, California, USA) containing the GFP-Rab27b fusion protein ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were cotransfected with hSyn-DsRed and the indicated construct on DIV 7 or DIV 19 (for older neurons) with 1 μg total purified plasmid DNA via CalPhos Mammalian Transfection Kit (Takara Bio) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2024Quote: ... Cultures were harvested after 7 days and Fabs were purified from culture supernatant using His60 Ni Superflow resin (Takara Bio #635660). Fabs were eluted from the column using a buffer of 50 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293 cells were cotransfected with the expression plasmids for D614G S or D614G/P681R (400 ng) with pDSP1-7 (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). To prepare target cells ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Neurons were transfected with GCaMP6 or NEMO-encoding plasmids at 7 to 9 days after plating using a calcium phosphate transfection kit (Takara Bio Inc).
-
bioRxiv - Bioengineering 2019Quote: The OVCAR-8 and MCF-7 cell lines were stably transfected using expression vectors encoding the fluorescent protein DsRed2 from Clontech (Mountain View, CA) according to previously reported protocols (Brimacombe et al. ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... The pLVSIN-EF1α-AcGFP-C1 vector (5.5 μg) was added to 7 μL Lentiviral Mix High Titer Packaging Mix (Takara Bio Inc., Otsu, Japan), 1500 μL serum-free DMEM ...
-
bioRxiv - Physiology 2024Quote: Flies treated with the same procedure as the lifespan assay were collected after 7-day EF/Sham exposure and homogenized in RNAiso reagent (Takara Bio, Shiga, Japan). Ten to twenty flies were homogenized in one tube ...
-
bioRxiv - Cancer Biology 2023Quote: ... sublines 14D7 and 24C7.8 The presence of the deletion on the translocated and the wildtype allele was validated by PCR using the Terra PCR Direct Polymerase Mix (Takara Bio Europe; supplemental Table 7). From line 14D7 ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...