Labshake search
Citations for Takara Bio :
1 - 50 of 608 citations for 6 Quinolinamine N N 3 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Immunology 2023Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Immunology 2022Quote: ... pmCherry-N’ (Clontech) between NheI and HindIII restriction sites ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.6 μl of 100 μM random primer (N)6 (TaKaRa, Kusatsu, Japan), with RNase-free water added up to 20 μl ...
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...
-
bioRxiv - Physiology 2020Quote: ... N-glycosidase F (PNGase, Takara, 4450) was used as previously reported [22] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Aliquots of total RNA (1 μg) were reverse transcribed using pd(N)6 random primer (Takara Bio) and Moloney murine leukemia virus (M-MLV ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Neuroscience 2019Quote: ... 2,3,5-trimethyl-3-thiazoline (TMT) was added to the panel as an outgroup and purchased from Clontech Enterprices ...
-
bioRxiv - Systems Biology 2020Quote: ... or pCMV-HA-N vector (Clontech #635690), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... and cloned into pmRFP-N vectors (Clontech). A construct coding for N-terminally GFP-tagged full-length rat Shank3 in the pHAGE vector was obtained from Alex Shcheglovitov (University of Utah) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The H2afx coding sequence from Mus musculus was ordered from Eurofins and cloned into the pOZ-N-FH backbone adding the 1xHA tag at the N terminus using the in-fusion HD cloning kit (#12141, Takara). Full length wild type H2afx coding sequence was then mutagenized to obtain the desired S139A point mutation.
-
bioRxiv - Molecular Biology 2022Quote: ... and Random Primer (nonadeoxyribonucleotide mix: pd(N)9) (TaKaRa) from the total RNA of Ophiocordyceps sp ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and VL648-N were cultured in YPDA (Takara, 630464) or SD-Trp Broth (Takara ...
-
bioRxiv - Microbiology 2024Quote: ... pCMV-Myc-N (635689; Clontech, Mountain View, CA, USA), and pEGFP-C3 (#6082-1 ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from tissues of 13-month-old wildtype C57BL/6J mice (n=3) using RNAiso Plus (Takara Bio). Complementary DNA (cDNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... and/or 1:200 anti-N-cadherin antibodies (TAKARA, M110) in 1% blocking regent (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminally and subcloned into pMSCV-IRES-Thy 1.1 vector (Clontech) using EcoRI and ClaI restriction sites.
-
bioRxiv - Cell Biology 2024Quote: ... and human adult heart RNA (n=4 pooled, Cat #636583, Takara) were used for bulk RNA sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... and cloned into pCMV-HA-N or pCMV-HA-C (Clontech). Notably ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reactions at every examined depth were performed in triplicate (n=3) using Takara SpeedSTAR HS DNA polymerase kit (Takara Bio USA, Madison, WI) with the following modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... FcγRIIA cDNA was cloned into a pEGFP-N vector (Takara Bio USA, CA). FTractin cDNA was fused with Halo tag in pTriEx-4 vector (Millipore Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... with an N-terminal GFP tag using the In-Fusion HD Cloning kit (Takara).
-
bioRxiv - Biochemistry 2022Quote: ... was added at the N-termini of EGFP and mCherry (Clontech, Mountain View, CA). For intramolecular FRET experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pyridylamination of N-glycans was performed using a pyridylamination manual kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: Syt1-Myc-tagged lentiviral constructs were generated using the pCMV-Myc-N vector (Clontech) containing full-length rat Syt1 and a preprotachykinin signal sequence cloned upstream of the Myc tag as described in ref.17 The F349A mutation was introduced using site directed mutagenesis (QuickChange ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct was fused to N-terminal of mCherry-N1 vectors (Takara, #632523). Generation of pFN21A-HaloTag-actin was described previously21.
-
bioRxiv - Cell Biology 2020Quote: ... Importin α with an N-terminal FLAG tag was cloned into pLVX-TetOne-Puro (Clontech) to generate stable cell lines ...
-
bioRxiv - Molecular Biology 2021Quote: ... An aliquot of the glycopeptide fraction was treated with peptide-N-glycanase F (PNGaseF, Takara, Shiga, Japan) in H218O to remove N-glycans and to label glycosylated Asn with 18O as Asp (18O) ...
-
bioRxiv - Microbiology 2020Quote: N-terminally Strep TagII tagged ZIKV Capsid was cloned to pLVX-TetOne-Puro Vector (Clontech, Cat: 631849) using BamHI & EcoRI cut sites ...
-
bioRxiv - Cell Biology 2020Quote: ... RRID:Addgene_17662) with an N-terminal mCherry fusion behind an EF1α promoter in a pLVX backbone (Takara Bio). The promoter plus gene fusion was then cloned into the pEGFP-BAF backbone by PCR and ligation ...
-
bioRxiv - Systems Biology 2023Quote: ... sSH2 domains were immediately purified by the N-terminal His6 tag with TALON® resin (Takara Bio) using a gravity column (detailed purification method in the Supporting Methods 1) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were anti-PLP (N-terminus; 1:5000, Rogers, 2008) anti-GFP (JL8; 1:2000 – 5000; Clontech); anti-alpha-Tubulin (DM1A ...
-
bioRxiv - Molecular Biology 2021Quote: ... The respective PCR products were then cloned into pcDNA5_FRT_TO_3xFlag(N) using In-Fusion® HD Cloning Kit (Cat. No. 639650, Takara).
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Cell Biology 2020Quote: ... A murine Sox21 cDNA with a N-terminal myc epitope was subcloned in a modified pTRE-Tight (Clontech) vector (pTT::myc-sox21) ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the wild-type CARD14 insert with N-terminal 3xFLAG tag was cloned into pBApo-EFalpha Pur DNA (Takara Bio) whose EF-1α promoter was replaced by TRE3G promoter obtained from pTRE3G (Clontech) ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing N-terminal GST tag and TEV protease recognition sequence was inserted into pCold I (Takara), followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Plant Biology 2022Quote: ... the N-terminal part is subject to self-activation in yeast64) inserted into pDONR221 were recombined into pGBKT7 (Clontech) to obtain BD- RGA ...
-
bioRxiv - Biochemistry 2022Quote: ... N-terminal Flag-tagged P38α containing 3C protease site was amplified by PCR using CloneAmp HiFi PCR Premix (Takara) and ligated in to pcDNA3 using the aforementioned restrictions sites ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... red fluorescence protein (DsRed) and NK-NT or NKN1 fragments were cloned into pET6xHN-N Vector (Takara, CA, USA). HEK293T cells were cultured in FP medium (DMEM containing 10% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... or into pHTN-HaloTag vector for GID4-HaloTag N-terminal fusion using the In-Fusion HD Cloning kit (Takara). Pro/N-degron coding sequence was cloned into pNLF1-C for MPGLWKS-NanoLuc C-terminal fusion ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Microbiology 2019Quote: ... and N-glycolylneuraminic acid (NeuGc) released were labeled with 1,2-diamino-4,5-methylenedioxybenzene (DMB) using a commercial kit (Takara, Shiga, Japan). The DMB-labeled sialic acids were analyzed by HPLC equipped with a TSK-ODS80Ts column (Tosoh ...