Labshake search
Citations for Takara Bio :
1 - 50 of 345 citations for 6 Oxabicyclo 3.2.1 octan 7 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Plant Biology 2022Quote: Yeast one-hybrid assays were performed using the Matchmaker Yeast One-Hybrid System (Clontech). The DNA fragment 1,000 bp upstream of the start codon ATG of DDRM2 was cloned into pHis2.1 vector and SOG1 was cloned into the pGADT7 vector ...
-
bioRxiv - Bioengineering 2021Quote: ... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: Yeast one-hybrid assays were performed using the Matchmaker Gold Yeast One-Hybrid System Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... yeast one-hybrid assays were performed as the manual of Matchmaker Gold Yeast One-Hybrid System (Clontech). The coding sequence of BnaA03.WRKY28 was cloned into pGADT7 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... One-step qPCR was performed using One Step PrimeScript™ III RT-qPCR Mix (Takara, Kusatsu, Japan) with primers as follows ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were assembled into pEMC vector one-by-one using in-fusion HD cloning kit (Takara), generating pEMC-eGFP-MBaMV ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLVX-Tet-One-Puro vector (Clontech, #631847), encoding for an engineered Tet activator and the corresponding inducible promoter ...
-
bioRxiv - Plant Biology 2019Quote: The Matchmaker yeast-one-hybrid system (Clontech) was used to test the binding of NaERF2-like and the NaEAS12 promoter in vitro according to the user manual ...
-
bioRxiv - Microbiology 2023Quote: ... expression plasmid pLVX Tet-One Puro (Clontech) was modified to have a MCS at the 3’end of Tet responsive promoter TRE3GS using EcoR1/BamH1 cut sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Systems Biology 2019Quote: MCF-7 Tet-On cells were purchased from Clontech and maintained as previously described (Liu et al. ...
-
bioRxiv - Genomics 2020Quote: Yeast one-hybridization assay was performed using the Matchmaker® Gold Yeast One-Hybrid System (Clontech, Palo Alto, CA, USA). The promoter sequence (upstream 2kb from the start codon ...
-
bioRxiv - Cell Biology 2021Quote: ... One microgramme of total RNA was reverse-transcribed using a One Step PrimeScript™ RT-PCR Kit (Takara, Liaoning, China) with a thermocycler ...
-
bioRxiv - Molecular Biology 2021Quote: ... One-step PrimeScript miRNA cDNA Synthesis Kit (Takara) was applied for reverse transcription ...
-
bioRxiv - Microbiology 2020Quote: ... One-Step PrimeScript RT-PCR Kit (Takara, RR064) was utilized for qRT-PCR (probe ...
-
bioRxiv - Genetics 2023Quote: ... Then One-step PrimeScript RT-PCR kit (Takara) was used to generate cDNA ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA from SARS-CoV-2 infected lung or trachea was subjected to one-step real-time reverse transcription PCR using One-step PrimeScript RT-PCR kit (Takara, RR064B). Multiplex PCR was performed to detect SARS-CoV-2 nucleocapsid gene and mouse Actb gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Developmental Biology 2020Quote: ... was cloned into pLVX Tet-One Puro plasmid (Clontech), packaged in 293T cells (from ATCC ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of PrimeScript One Step Enzyme Mix (TaKaRa), 10 μL of 2× One Step RT-PCR buffer (TaKaRa) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in a Mupid-One gel electrophoresis system (TaKaRa, Japan). RNA samples were purified for the second time by the TRIzol method as mentioned above and were stored at −80°C until further analysis.
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of extracted RNA was subjected to one-step real-time RT-PCR using a One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (TaKaRa Bio Inc.) on a QuantStudio 5 Real-Time PCR system (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The extracted RNAs were subjected to one-step real-time PCR using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (TaKaRa Bio Inc.).
-
bioRxiv - Plant Biology 2023Quote: ... The yeast two-hybrid and one-to-one confirmation experiments were performed according to Matchmaker™ Gold Yeast Two-Hybrid System User Manual (Clontech, https://www.clontech.com/). Primers for vector construction were listed in Table S8.
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2-NTCP and Huh-7 cells with RNAi plus (TaKaRa, Japan) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The One-step PrimeScript miRNA cDNA Synthesis Kit (Takara, Japan) was utilized for reverse transcription ...
-
bioRxiv - Systems Biology 2019Quote: ... Lenti-X™ Tet-One™ Inducible Expression System (Clontech) was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... PrimeScript II High Fidelity One step RT-PCR Kit (Takara) was used with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of 2× One Step RT-PCR buffer (TaKaRa), and 5 μL ddH2O ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were grown one more day in NDiff 227 media (Takara) supplemented with 1 µM PDO325901 and 3 µM CHIR99021 (NDiff + 2i) ...
-
bioRxiv - Biochemistry 2021Quote: ... One-step PrimeScript™ RT Reagent Kit (Takara, Japan, Cat.#RR064A) Kit were used for quantitative real-time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... pombe genome using KOD One DNA polymerase (TaKaRa Bio Inc., Japan). The first PCR products were used as primers in the second PCR step to amplify a cassette for integration ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...