Labshake search
Citations for Takara Bio :
1 - 50 of 590 citations for 6 Bromo benzo d isoxazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2022Quote: ... D/D solubilizer (635054) from Takara, VECTASHIELD Mounting Medium (H-1400 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested after 3 d and AAV6 was purified with a filtration-based kit (Takara AAVpro Purification Kit) per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... D/D solubilizer were purchased from Clontech. Methyl-β-cyclodextrin and 2-hydroxypropyl-β-cyclodextrin were purchased from Wako Chemicals ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Cell Biology 2023Quote: 1.0 μM of D/D solubilizer (Takara, Cat: # 635054) in Opti:MEM® (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Cell Biology 2023Quote: ... Release of TfR from the ER was triggered by adding D/D solubilizer (Takara Bio) to the live-cell imaging solution at a final concentration of 1 µM.
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Cell Biology 2020Quote: PC4 cells (Gordon et al., 2017) were incubated with 0.5 µM D/D Solubilizer (Takara; 635054) in a time course-dependent manner ...
-
bioRxiv - Microbiology 2019Quote: ... D-2AA was purchased from Takara Bioscience (USA) ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were first incubated with ARIAD ligand at a concentration of 1 µM (AL; D/D Solubilizer; Takara) for the indicated times ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... P3 and NP from D/660 and D/CN286 were amplified from the respective bidirectional pHW2000 plasmid constructs using CloneAmp Hifi PCR mix (Takara) with the following cycle profile ...
-
bioRxiv - Cell Biology 2020Quote: ... generates a protein that undergoes spontaneous aggregation that reverses upon the addition of D/D solubilizer (catalogue# 635054; Takara Bio), a cell-permeant rapamycin analog that binds to the FM4 domains (see Fig 3e).
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... HEK-D (see below) and Lenti-X 293T (Takara) cells were cultured in growth medium consisting of Dulbecco’s modified Eagle’s medium (GIBCO) ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Microbiology 2021Quote: ... complementary to the DENV 3’UTR at 65°C for 3 hrs using ExpressHyb hybridization buffer (Clontech). Autoradiographs were quantified using ImageQuant (GE Healthcare).
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...