Labshake search
Citations for Takara Bio :
1 - 50 of 553 citations for 5 β DIHYDRO 17 HYDROXYPROGESTERONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Microbiology 2023Quote: ... as previously described (17): pcDNA3.1+-based plasmids used for ectopic expression and pRetroX-tight-Puro-based ones (Clontech, cat. PT3960-5) used here to generate stable cell lines expressing ISG20 upon induction with doxycycline (dox.) ...
-
bioRxiv - Biochemistry 2021Quote: ... The β-galactosidase expression vector pCMV-β (CLONTECH, Palo Alto, CA, USA) was used as an internal control ...
-
bioRxiv - Cancer Biology 2020Quote: ... Day 17 embrionic RNA was used to validate primers (Clontech/Takara). cDNA was synthesised with Superscript III (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Day 17 embrionic RNA was used to validate primers (Clontech/Takara). cDNA was synthesised with Superscript III (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... Tcrb amplicons were prepared using a 5’RACE-based protocol with the SMARTer Mouse TCR α/β Profiling Kit (Takara #634402) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and purified cDNA was eluted in 17 µL elution buffer provided by Clontech. All samples were quantitated using Bioanalyzer 2100 Instruments (Agilent Genomics) ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified cDNA was eluted in 17 μl elution buffer provided by Takara. All samples were quantitated using PicoGreen® on Molecular Dynamics M2 SpectraMax instrument ...
-
bioRxiv - Plant Biology 2020Quote: For β-galactosidase assay constructs were processed according to the instructions of the β-galactosidase assay kit provided by Clontech. For each construct ...
-
bioRxiv - Molecular Biology 2020Quote: ... The empty coding vector pcDNA3.1/MYC-His was obtained from Invitrogen and pCMV-β-Galactosidase was obtained from Clontech/Takara Bio.
-
bioRxiv - Biochemistry 2022Quote: ... Normalization was made by measuring the β-Gal activity after 1-hour incubation of 7.5 µl of cellular extract with 50 µl of β-Gal substrate (β-Gal detection kit II, Clontech).
-
bioRxiv - Cell Biology 2023Quote: ... The β-galactosidase activity was determined by ONPG (o-nitrophenyl β-D-galactopyranoside) liquid assay (quantitative) as mentioned elsewhere (Clontech Laboratories, 2008). β-galactosidase activity from each sample was calculated from at least three biological replicates and the concentration of cells (O.D.600 ...
-
bioRxiv - Physiology 2021Quote: ... 0.26 μg of pCMX-PPARγ vector and 0.1 μg of β-galactosidase expression plasmid (CMV-β-Gal) (Clontech, now Takara Bio USA. Inc) vector for normalization.
-
bioRxiv - Physiology 2021Quote: ... 0.26 μg of pCMX-PPARγ vector and 0.1 μg of β-galactosidase expression plasmid (CMV-β-Gal) (Clontech, now Takara Bio USA. Inc) vector for normalization.
-
bioRxiv - Cell Biology 2020Quote: ... EGFP-tagged human β-actin (Clontech, Mountain View, CA, USA) was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... phospho-specific mutant constitutively active NFATC4 17 was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4 ...
-
bioRxiv - Microbiology 2023Quote: ... HEK-293/17 cell media were harvested and concentrated overnight with a Lenti-X concentrator (Clontech, Mountain View, CA) according to the manufacturer’s protocol and resuspended in 10-fold less media volume prior to concentration.
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Genetics 2021Quote: ... The plasmid was linearized using AgeI and SalI restriction enzymes and inserts were cloned to the linearized plasmid in 17 reactions using the standard InFusion cloning (Clontech) protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA encoding HsPINK1 was inserted into the BamHI site of pcDNA5/FRT/TO CMVd3 vector (pcDNA5d3, see (17)) using the In-Fusion HD Cloning Kit (Takara). For stable expression ...
-
bioRxiv - Cell Biology 2019Quote: ... and 4 μg of pCMV-β-galactosidase (Clontech Laboratories, Inc., CA, USA) using electroporation according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a luminometric β-galactosidase detection kit (Takara Bio, Palo Alto, CA) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Neuroscience 2021Quote: ... coated T-225 flasks containing 85-95% confluent HEK-293T/17 cells (ATCC, CRL-11268) were each transfected (Xfect, Takara #631318) with a DNA cocktail containing the 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants from rescue plates were passaged on 15 cm plates of HEK 293T/17 cells (ATCC) transfected with pLV-TTBG and pLV-TTBL (described above) using Xfect transfection reagent (Takara 631318) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Developmental Biology 2020Quote: ... Pegl-17::GFP1-10 constructs were generated by cloning egl-17 promotor and GFP1-10 sequences into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). The plasmid was injected into SPC-1::GFP11×7 knock-in animals ...
-
bioRxiv - Molecular Biology 2022Quote: ... These sequences were obtained from pPIGA3GFP (inverted repeats of piggyBac transposon [17]) and pAcGFP-Hyg C1 vector (CMVp-AcGFP and SV40p-Hyg) (632492; Takara Bio USA). Recombinant baculovirus was then produced using a Bac-to-Bac system ...
-
bioRxiv - Plant Biology 2021Quote: ... Liquid β-galactosidase assays were performed as described in the Yeast Protocols Handbook (Clontech). A Y2HGold yeast strain containing a bait vector was mated with the Y187 strain containing the pGADT7 vector and selected on SD/-Trp/-Leu media ...
-
bioRxiv - Cell Biology 2023Quote: ... 14-3-3τ and β-actin were designed and synthesized by Takara (Table 1). To run the real-time PCR reaction ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Plant Biology 2021Quote: ... β‐galactosidase assay was performed according to the manufacturer’s protocol (Matchmaker Two‐Hybrid System; Takara Bio ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Cell Biology 2020Quote: ... KIF21B-GFP and β-tubulin-GFP sequences were cloned in pLVX-IRES-Puro vectors (Clontech), EB3-GFP was cloned in pLVX-IRES-Hygro vector (Clontech) ...
-
bioRxiv - Pathology 2024Quote: ... FAP and β-actin mRNA expression were determined using TB Green Premix Taq (Takara Bio). The primers used for β-actin were as follows ...
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Genomics 2019Quote: ... and the expression of IFN-β and IL-6 were measured by quantitative PCR (TAKARA, RR820A). The sequences of the primers were listed in the Supplementary Table 4.
-
bioRxiv - Immunology 2020Quote: TCR repertoire profiling was performed using the SMARTer TCR α/β Profiling Kit (Takara Bio, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: TCR repertoire profiling was performed using the SMARTer TCR α/β Profiling Kit (Takara Bio, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Cell supernatants were collected at 24 and 48 h after transfection of HEK 293/17 cells and concentrated using a LentiX concentrator (Takara Bio USA, Inc., Mountain View, CA). HEK 293/17 cells or NSC cells were plated in 6 well plates at a density of 105 per well ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’RACE was carried out using a 5’ Full RACE Core Set (Takara Bio). The first PCR was performed using the single strand cDNAs concatenated by T4 RNA ligase and primers S1 (5’-TTC TAT ACC ATC GTC TAC CCG CTG AGC TTC-3’ ...