Labshake search
Citations for Takara Bio :
1 - 50 of 1015 citations for 3 Phenoxybenzoic Acid Unlabeled 100 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 2 ug/mL doxycycline (Clontech, Cat. No. 631311). i3Neurons were then fed three times a week by half media changes ...
-
bioRxiv - Neuroscience 2020Quote: ... and pHelper (Cellbiolabs VPK-401) (per 15 cm plate, 15.5 ug, 21.0 ug, and 33.4 ug respectively) using Xfect (Clontech 631318) transfection reagent ...
-
bioRxiv - Immunology 2022Quote: ... OVA and GFP expression was induced by adding 1 ug/ml doxycycline (Takara, 631311) to the culture medium ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 ng/ml doxycycline (Clontech) was added 24 hours post-transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 mM maleic acid buffer pH 5.5) containing 100 mg Yatalase (Takara) and 100 mg Lysing Enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 U/mL RNase inhibitor (TAKARA)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 U/ml RNase inhibitor (TAKARA), Complete Protease Inhibitor EDTA-free in nuclease-free water) ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Cell Biology 2023Quote: ... Flow-sorted cells were cultured in ex vivo GT media in a 96 well flat bottom plate coated with 33.3 ug/ml of Retronectin (Takara). The 62 hr protocol consisted of pre-stimulation in GT media (24 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 100 ng/ml Doxycycline (Clontech #631311) and 0.1 μl RNAiMAX per pmol siRNA (Thermofisher Scientific #13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... or 100 ng mL-1 anhydrotetracycline (aTc) (Takara), as necessary.
-
bioRxiv - Pathology 2020Quote: ... 100 μg/ ml Dnase I (Cat.#2270A, TaKaRa) and 100 μg/ml Rnase A (Cat.#AC118 ...
-
bioRxiv - Neuroscience 2023Quote: Five ug of total RNA from human total brain (Clontech) was reverse transcribed using GeneRacer oligo-dT primer and SuperScript III First-Strand Synthesis System (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were transduced on RetroNectin (100 µg/mL; Takara)-coated plates at an MOI of 5 and the transduced population was enriched by puromycin (3 µg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 ug total RNA and PrimeScript RT Master Mix (Takara, Japan) was used for reverse transcription in a SimpliAmp Thermal Cycler (Life technologies ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 2 ug Retronectin (TaKaRa Cat. no. T110A), 1 ug anti-mouse CD11a (LFA1) ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatant was collected two and three days after transfection of GP2-293T cells and concentrated onto wells of a 6 well plates coated with Retronectin (Takara Bio, 5 ug/ml) by spinning at 2500g for 90 minutes at 32° C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was bound to 3 mL (=1.5 mL bed volume) Talon SuperFlow Metal Affinity Resin (TaKaRa) per protein preparation ...
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... in 6-well plates pre-coated with 15 ug retronectin (Takara T100A). Plates were spinfected by centrifugation at 2500 rpm 32C for 90 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Bioengineering 2022Quote: About 130 ml of clarified cell suspension was combined with 3 mL of TALON® resin (Takara Bio 635503) previously equilibrated in lysis buffer and rocked at 4°C for 1 h ...
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... to OD600 0.2–0.3 with 2–3 mL fresh AYE +Fe +Cys containing 40 ng/mL anhydrous tetracycline (aTC, Clontech 631310). On the third day ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 ug RNA was reverse transcribed using a PrimeScript RT-PCR kit (Takara Bio) by following the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Template DNA was extracted from antenna or leg of the individuals by placing them in 50 μL of 5% Chelex solution (Chelex 100, 100–200 mesh, Bio Rad) and 0.5 μL of proteinase K (20mg/mL, Takara Bio Inc.), then incubating for 24 h at 56 °C and 5 min at 95 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of the reporter was induced with 100 ng/mL anhydrotetracycline (Clontech, #631310) for 6-8 hours ...
-
bioRxiv - Microbiology 2023Quote: ... The cleared lysate was loaded onto a 25 mL free-flow gravity column (GeneFlow) packed with 3 ml TALON® Metal Affinity Resin (Takara Bio), washed with 10 column volumes (CV ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA (150 ug) was treated using the OligotexTM -dT30
mRNA Purification Kit (Takara Bio). The purified poly(A)+ RNA was reverse-transcribed with oligo(dT ... -
bioRxiv - Genomics 2019Quote: ... reverse transcription was initiated from the bridge 3’ OH by adding 2 μL SMARTScribe Reverse Transcriptase (100 U/ μL, Clontech) and incubating for 1 h at 42 °C with shaking at 800 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... To purify the probes, 1/3 of the transcription reaction was loaded on a pre-spun (700xg, 5minutes) Chromaspin-100 column (Clontech) and centrifuged (700g ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were diluted to 25,000 cells/mL and dispensed into ICELL8 3’ DE chips (Takara Bio, CA) using an MSND device (Takara Bio) ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Biochemistry 2020Quote: ... The final supernatant was supplemented with NaCl to 150 mM and incubated with 3 mL His60 resin (Takara Biosciences) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant with the soluble His6-UppH was loaded on to a 3 ml TALON Metal Affinity Resin (Clontech) equilibrated in binding buffer (50 mM Na2HPO4 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cDNA was synthesized with 1 ug total RNA using the PrimeScriptTM RT Reagent Kit with gDNA Eraser (TaKaRa). qRT-PCR was performed using a qTOWER3G system (analytikjena ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 ug of RNA was reverse-transcribed into cDNAs using the Prime Script RT Reagent Kit (Takara, RR037B) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Physiology 2021Quote: ... The RNA (1 ug/sample) was reverse transcribed into cDNA and Q-PCR was performed using a SYBR Green PCR kit (Takara) in a Light Cycler (Eppendorf) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Aliquots of 2.0 ug of the total RNA were collected for cDNA synthesis by using Clontech Oligo dT cDNA synthesis kit (Takara Bio USA ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...