Labshake search
Citations for Takara Bio :
1 - 50 of 6166 citations for 3' 3' Cyclic GAMP cGAMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: The transcription initiation and termination sites of OGRU were detected by 5’ and 3’ RACE using a SMARTer® RACE 5’/3’ Kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...