Labshake search
Citations for Takara Bio :
401 - 450 of 2708 citations for 6 CHLORO 2 3 4 9 TETRAHYDRO 1H CARBAZOL 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Neuroscience 2024Quote: ... and individual cells were captured in separate wells of a 96-well plate containing 4 μl lysis buffer (1 U/μl RNase inhibitor [Clontech, Cat#: 2313B]), 0.1% Triton (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Doxycycline (2 mg/L, Clontech) was also included on d0 to induce TetO gene expression by binding to rtTA and the TetO promoter upstream of the Ngn2 gene ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline (Takara) was added on day 0 to induce TetO gene expression ...
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was amplified using PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio, Shiga, Japan) under the following reaction conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and one μg RNA was converted to cDNA by using the PrimeScript™ RT-PCR Kit (Takara, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... a one-step reverse transcription-PCR (RT-PCR) assay was conducted with a PrimeScript kit (Takara, Tokyo, Japan), and Viral genomic terminal sequences were determined using commercial 5’ and 3’ RACE (rapid amplification of cDNA ends ...
-
bioRxiv - Immunology 2020Quote: ... q-RT-PCR was performed using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time; TaKaRa). The primers used for q-RT-PCR were selected to be specific for the E and ORF1ab sequences in the SARS-CoV-2 genome (Table 1) ...
-
bioRxiv - Bioengineering 2021Quote: ... One microgram of RNA was reverse transcribed into cDNA using a PrimeScript™ RT reagent Kit (TaKaRa, RR037A) in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was reverse transcribed to cDNA using RevertAid First Strand cDNA Synthesis Kit (TaKaRa) and stem-loop primers ...
-
bioRxiv - Plant Biology 2021Quote: ... one microgram of DNase-treated RNA was used for reverse transcription using a PrimerScript RT reagent kit (Takara) and a mix of oligo poli-dT and random hexamers ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was performed using the One Step TB Green PrimeScript PLUS RT-PCR Kit (RR096A, TaKaRa, Japan) and a Thermal Cycler Dice Real Time System TP800 (TaKaRa ...
-
bioRxiv - Immunology 2024Quote: ... A stable IFN-λ-expressing cell line was obtained by transfection of one million Lenti-X (HEK293T, Takara) cells with 500 ng Super PiggyBac Transposase vector and 1250 ng of PiggyBac transposase mammalian expression vector using Lipofectamine 3000 following to the manufactureŕs instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... we confirmed successful repair by extracting mRNA and performing one step RT-PCR (Takara Primescript High Fidelity, RR057B). Primer sequences and design are detailed in Supplementary Fig 1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... One µg of total RNA was processed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China). Amplified products were sequenced and verified after cloning into a pJET1.2-T vector through CloneJET PCR Cloning Kit (Thermo Scientific ...
-
bioRxiv - Physiology 2024Quote: ... Three volumes of concentrated virus medium were subsequently mixed with one volume of Lenti-X concentrator (Takara Bio) and rotated at 4°C overnight before centrifugation (1500 g for 45 min at 4°C) ...
-
bioRxiv - Zoology 2024Quote: ... One µg of total RNA was processed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China). The PCR procedure was set as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... One microgram of total RNA was subjected to first strand cDNA synthesis using PrimeScript RT Reagent kit (Takara). The target cDNA was amplified using TB Green Premix Ex Taq II (Takara ...
-
bioRxiv - Cell Biology 2024Quote: ... One microgram of total RNA was subjected to first strand cDNA synthesis using PrimeScript RT Reagent kit (Takara). The target cDNA was amplified using TB Green Premix Ex Taq II (Takara ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2020Quote: ... which corresponds to the S23Q/L24M mutant of SARS-CoV-2 Wuhan-Hu-1 ORF3b *57) was generated by overlap extension PCR by using PrimeSTAR GXL DNA polymerase (Takara), the SARS-CoV-2 ORF3b 155* as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Telomerase-mediated extension and subsequent amplification of TRAP products were conducted in 25-µL reactions containing 1 µL of cell lysate and 2 U of Titanium Taq DNA polymerase (Takara). The other kit components—TRAP reaction buffer ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells were seeded in a 6-well plate at a density of 6 × 105 cells/well and co-transfected with pSIN-siU6 – shSLFN11/ shSLFN12/ shSc (2 μg) along with plasmids pGP (1 μg, Takara) and pPE ampho (1 μg ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 12.5 µl using the Advantage HF 2 PCR Kit (Takara Bio) with 1X Advantage 2 PCR Buffer ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Cell Biology 2019Quote: ... for 30 min at 37°C in a moisture chamber followed by an incubation with anti-GFP (1:100 in PBSA) antibody at 4°C for 72 h (Takara 632381/JL-8)) ...
-
bioRxiv - Physiology 2019Quote: ... Membranes were incubated at 4°C in primary antibodies diluted 1:1000 in 5% bovine serum albumin: anti-GFP (ClonTech Living Colours #ab632375), anti-HSP60 (Department of Biology ...