Labshake search
Citations for Takara Bio :
3051 - 3100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The first PCR was performed using PrimeSTAR GXL polymerase (Takara) and 1:2000 SYBR Green I (20 μL/reaction ...
-
bioRxiv - Immunology 2023Quote: ... Purified lymphocytes were homogenized in RNAiso Plus (Takara Bio Inc., Kusatsu, Japan) and stored at -80 °C until use ...
-
bioRxiv - Genomics 2023Quote: ... the qPCR reactions were carried out using Premix Ex Taq™ (RR390A, TaKaRa) containing 2 μL of cDNA ...
-
bioRxiv - Genomics 2023Quote: Five µg of each Quartet RNA sample was reverse transcribed using the PrimeScript™ RT reagent Kit (RR037A, TaKaRa) in a 50 µl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... and isolated by NucleoSpin Plasmid (TaKaRa). The introduced mutation was verified by Sanger sequencing.
-
bioRxiv - Microbiology 2023Quote: ... All PCRs were performed using PrimeSTAR Max polymerase (Takara Bio, catalog no. R045B) per the manufacturer’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... added on a retronectin-coated (Takara T100A) non-tissue culture 24-well plate and spun for 90 minutes at 2500 rpm at 10°C ...
-
bioRxiv - Immunology 2023Quote: 7 μg of lentiviral vectors was mixed with Lenti-XTM packaging single shots (Clontech) in a final volume of 600μl for 15min before the transfection mix were added to 4 million of Lenti-X TM 293T cells seeded on a 10 cm2 tissue culture dish ...
-
bioRxiv - Immunology 2023Quote: ... The titer of viral particles was estimated using a Lenti-X p24 Rapid Titer Kit (Clontech) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Full length cDNAs were generated and amplified directly from a single cell through the SMART-Seq HT Kit (Takara Cat. No. 634437). Up to 200pg cDNAs were used to generate the dual index Illumina libraries using Nextera XT DNA Library Prep Kit (Illumina Cat No ...
-
bioRxiv - Immunology 2023Quote: ... Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio). The analysis of the surface markers of the positive cells was performed on FlowJo.
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Genetics 2023Quote: ... electrophoresis was performed using 9 μL of the PCR products on a 2% agarose gel (Takara Bio, Japan) at 100 V ...
-
bioRxiv - Immunology 2023Quote: ... retronectin-treated plates were prepared by coating with 12.5 μg/ml retronectin (TaKaRa) in PBS (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... pCMV-GFP-N1 (Clontech). pEF1-K6a (no tag ...
-
bioRxiv - Cell Biology 2023Quote: ... 4µg of pHelper (Takara Bio), 4µg of transfer plasmid and 48µg of PEI MAX per dish ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA was isolated from the cells using TRIzol (RNAiso; Takara) by following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg RNA was subsequently converted to cDNA using random hexamer primer using PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio) in accordance with manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVXE-Blast::mCherry-TagRFP-Luciferase (RFP-cyto) was constructed by PCR and ligation of mCherry-TagRFP-Luciferase from 2xRFP-luciferase into a pLVXTight lentiviral vector (Clontech) previously modified to contain the EF1a promoter and blasticidin resistance.
-
bioRxiv - Cell Biology 2023Quote: ... the media was collected and viral particles were concentrated using Lenti-X™ Concentrator (Takara Bio Inc., 631231). For transduction ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing UAS-eGFP was subjected to 14 cycles of PCR amplification (SMARTer Seq V4 Ultra Low Input RNA Kit; Takara Bio). 1 ng of amplified RNA was used to prepare cDNA libraries (Nextera XT DNA library preparation kit ...
-
bioRxiv - Plant Biology 2023Quote: The vectors and yeast (Saccharomyces cerevisiae) strains provided in the Matchmaker Gold Yeast Two-Hybrid System (Clontech) were used to perform directed interaction analyses (dY2H) ...
-
bioRxiv - Biophysics 2023Quote: ... Some viruses were concentrated using Lenti-X Concentrator (Takara Cat. # 631232) following vendor protocols and were concentrated 1/10 ...
-
bioRxiv - Bioengineering 2023Quote: ... a PGK promoter-driven mCherry expression cassette and the WPRE element were inserted into pMSCV (Clontech, Takara Bio) at the XhoI and ClaI sites to generate an empty vector (pMSCV-mCherry-WPRE) ...
-
bioRxiv - Bioengineering 2023Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and cotransfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Bioengineering 2023Quote: ... 741-bp PCR product amplified from pCMV-mCherry-C1 (Clontech Laboratories, Inc.) using primers 5’-ATTACCGGTGTTAACATGGTGAGCAAGGGCGAGGA and 5’-TAAACCGGTCTTAAGTTACTTGTACAGCTCGTCCATG was cloned into AgeI-digested pAAV-JeT-DIO-MCS.
-
bioRxiv - Bioengineering 2023Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and cotransfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Bioengineering 2023Quote: ... a PGK promoter-driven mCherry expression cassette and the WPRE element were inserted into pMSCV (Clontech, Takara Bio) at the XhoI and ClaI sites to generate an empty vector (pMSCV-mCherry-WPRE) ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA inserts were PCR amplified using Ex Taq DNA Polymerase (Takara, cat#RR001A) from sufficient genome equivalents of DNA to achieve an average coverage of >200x of the sgRNA library ...
-
bioRxiv - Microbiology 2023Quote: iSLK cells and Lenti-X 293T (Takara) were maintained in DMEM (Gibco +glutamine ...
-
bioRxiv - Genetics 2023Quote: ... The purifications for PALS-C steps were done with NucleoSpin Gel and PCR Clean-Up kit (Takara, 740609). Final assembled products were delivered to Endura Electrocompetent Cells (Lucigen ...
-
bioRxiv - Genetics 2023Quote: ... GoStix Value (GV) quantified by the Lenti-X GoStix App (Takara) was used to scale the titer of each block to be the same ...
-
bioRxiv - Genetics 2023Quote: ... Lentivirus was titrated with Lenti-X GoStix Plus (Takara, 631280). For lentiviral transduction ...
-
bioRxiv - Genetics 2023Quote: ... mixed with 5 mL Lenti-X Concentrator (Takara, 631232) and rocked at 4 °C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated from cells or tumors using a Mini BEST Universal RNA Extraction Kit (Takara, Shiga, Japan). cDNA was prepared from total RNA by reverse transcription using oligo-dT primers (Takara) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared from total RNA by reverse transcription using oligo-dT primers (Takara). RT-qPCR was conducted using SoFast EvaGreen Super Mix (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2023Quote: ... here we inserted the two chaperones GroES and GroEL from the pGro7 plasmid (TaKaRa). The sequence for GroES and GroEL were amplified from the pGro7 plasmid by PCR and inserted into the linearized plasmid with NpnJ by In-Fusion® ...
-
bioRxiv - Synthetic Biology 2023Quote: ... ∼¼ of a healthy uniform colony was suspended in complete synthetic medium (SCM) (Takara Bio USA). The cell concentration of each inoculum was measured by flow cytometry and then diluted to 1 cell/ul in an erlenmeyer flask ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The collected viral supernatant was concentrated using the Lenti-X concentrator (Takara Bio 631232) following manufacturing protocol.
-
bioRxiv - Synthetic Biology 2023Quote: ... coated with RetroNectin (Takara Bio; T100B), where 3×105 activated T cells were seeded and then spun by centrifugation for 1000 g ...
-
bioRxiv - Plant Biology 2023Quote: OsbZIP1.1 and OsbZIP1.2 CDS were cloned in pDEST-GBKTT7 (CD3-764) obtained from TAIR (https://www.arabidopsis. org) and transformed in the AH109 yeast strain (Clontech, TaKaRa Bio, USA). Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Plant Biology 2023Quote: OsbZIP1.1 and OsbZIP1.2 CDS were cloned in pDEST-GBKTT7 (CD3-764) obtained from TAIR (https://www.arabidopsis. org) and transformed in the AH109 yeast strain (Clontech, TaKaRa Bio, USA). Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Plant Biology 2023Quote: ... pGBKT7 and pGADT7 (Clontech, now Takara Bio, San Jose, CA, USA), as well as in pMETOYC-Dest (Xing et al ...
-
bioRxiv - Plant Biology 2023Quote: ... using the In-Fusion system (Takara Bio, Shiga, Japan). The resultant MpFGMYB plasmid was digested with PmeI and NotI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we concentrated harvested virus samples using a polyethylene glycol (PEG)-based method (65) using PEG 6000 (Wako #169-09125) or Lenti-X Concentrator (Takara #631231). When PEG 6000 was used ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...