Labshake search
Citations for Takara Bio :
101 - 150 of 1462 citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... which was performed using a SMARTer RACE 5’/3’ Kit (Clontech Laboratories, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Microbiology 2021Quote: PDGFRβ-targeted sgRNA (5’-CCGGTGAGAGCCACCCTGACAGTG-3’) was cloned into the pGuide-it-ZsGreen1 vector (Takara, Biomedical Technology, Beijing, China). This plasmid could simultaneously express Cas9 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The template plasmid for the mCherry-targeting ssDNA was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa), the upstream genome sequence of the stop codon of Rtl5 and downstream of the predictive cut site by Cas9 ...
-
bioRxiv - Microbiology 2020Quote: 5’-RACE analysis was performed using SMARTer RACE 5’/3’ kit and In-Fusion HD Cloning kit according to the manufacturer’s instructions with slight modifications (Clontech). 5’-RACE ready cDNA was synthesized from purified mRNA (TG ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of mRNA was performed using 3-5 μg RNA with RNA to cDNA EcoDry Premix (Takara, #639549). For real-time PCR analysis ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The plasmid for mCherry insertion was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa). The 5’ arm is the genomic sequence upstream of the stop codon of Rtl9 and the 3’ arm is downstream of the predictive Cas9 cut site ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers P5 and P6 were annealed to create a dsDNA molecule encoding the sgRNA sequence with 5’ and 3’ extensions to enable InFusion Cloning (Clontech) into BtgZI-digested pL6 ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...