Labshake search
Citations for Takara Bio :
1351 - 1400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: Total RNAs were extracted using the RNAiso Plus reagent (TaKaRa, Ostu, Japan), which were converted into cDNA with Superscript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... These three fragments were cloned into EcoRI-digested pBluescript-II vector using In-Fusion HD cloning kit (Takara). gRNA plasmids were constructed by cloning of annealed oligo DNA (Ti902/903 and Ti904/905 ...
-
bioRxiv - Genetics 2024Quote: ... and indexing primers (DNA HT Dual Index kit, Takara Bio) with all procedures performed as per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... ∼0.37 pg) per tube—was subjected to amplification using a PicoPLEX® Gold Single Cell DNA-Seq Kit (Takara Bio) and indexing primers (DNA HT Dual Index kit ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was cloned into the KpnI site of the pCRtk2×2NN vector (RDB18670) to generate pCRtk-PDX1 using an In-Fusion HD Cloning Kit (639648; Takara Bio Inc., Shiga, Japan). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutant 3×FLAG-tagged hRubicon vectors were generated using an in-Fusion reaction (TaKaRa Bio). The mCherry-tagged mRubicon was subcloned into pMRX-IRES-bsr ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 ml of RNA Iso Plus (Takara Bio) was added to cells and incubated for 5 minutes at RT ...
-
bioRxiv - Microbiology 2024Quote: ... coli Rosetta competent cells (TaKaRa) and used for the expression and purification of recombinant GST-Rbp3 protein as follows ...
-
bioRxiv - Cell Biology 2024Quote: Arrayed slides were blocked in PBST containing 3% (w/v) powdered milk within an Atlas Glass Hybridisation Chamber (Clontech, CA, USA) then hybridised to 400µl fluorophore-tagged peptide for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... coli and purified using either Talon cobalt resin (Clontech) or HisPur cobalt resin (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR product was inserted into the plasmid pACYC184 digested using BamHI and EagI by infusion cloning (Clontech, USA), as reported previously (56) ...
-
bioRxiv - Genomics 2024Quote: ... RNase inhibitor (0.4 U/µl; Takara, 2313B), SUPERase·In (0.2 U/µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... Yeast strain AH109 (Clontech, Takara Bio USA) was used for yeast two-hybrid interaction studies as a tester strain ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Lenti-X 293T (Takara 632180) cells were maintained in DMEM ...
-
bioRxiv - Genetics 2024Quote: ... or anti-Myc (9E10, Takara Bio) antibodies coated to Protein A Dynabeads (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... albopictus promoter from AALFPA_045636 and by introducing XbaI restriction sites using In-Fusion cloning (Takara) on four fragments amplified using the primers in Table S2 ...
-
bioRxiv - Neuroscience 2024Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel at two different time points using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was generated from total RNA using the Prime Script reagent kit (Takara #RR047A). Candidates of ΔPtth were characterized by the loss of DNA band in the deleted areas through PCR on the genomic DNA and cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative PCR was performed on Thermo Piko Real 96 (Thermo) using SYBR Green PCR Master Mix (Takara #RR820A). The mRNA expression level was calculated by the 2−ΔΔCt method and the results were plotted by using tubulin as the reference gene ...
-
bioRxiv - Neuroscience 2024Quote: ... a PGK promoter-driven mCherry expression cassette and the WPRE element were inserted into pMSCV (Clontech, Takara Bio) at the XhoI and ClaI sites to generate an empty vector (pMSCV-mCherry-WPRE) ...
-
bioRxiv - Neuroscience 2024Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and co-transfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Systems Biology 2024Quote: ... Ligated plasmid products were transformed into stellar competent cells (E. coli HST08 strain, Takara Bio). See Dataset EV1 for full descriptions of constructs.
-
bioRxiv - Systems Biology 2024Quote: The pool of duplets was ligated to each of the barcoded promoter vectors using Takara ligation kit version 2.1 (#6022; Takara). Ligation products were purified using magnetic bead purification and 2 µl of the ligation were electroporated into 20 µl of electrocompetent e ...
-
bioRxiv - Plant Biology 2024Quote: ... A volume of 2 µg of total RNA was reverse transcribed into single-stranded cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China). The primer sequences used for qRT-PCR are listed in Supplementary file 1b ...
-
bioRxiv - Systems Biology 2024Quote: ... SMART-Seq V4 Plus kit (Cat# R400753) was purchased from Takara Bio USA.
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral supernatants generated in Lenti-x HEK-293T cells (TAKARA, #632180) using the 2nd generation packaging system (plasmids psPAX2 ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK-293T cells (Clontech) were grown in DMEM (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... mCherry (Clontech), pmRFP-LC3 (Addgene #21075 ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 ng of total RNA was used as input for the SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio USA. Inc), which converts poly(A ...
-
bioRxiv - Cancer Biology 2024Quote: ... The virus was filtered and concentrated using the Lenti-X Concentrator (Takara Bio) according to manufacturer’s instructions and resuspended in serum-free media.
-
bioRxiv - Cell Biology 2024Quote: ... Hippocampal neurons were transfected on DIV11-13 using the CalPhos Mammalian Transfection kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively) were inserted into the KpnI and XbaI sites of the vector using the In-Fusion HD Cloning Kit (TaKaRa).
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was used to synthesize cDNA using the SMART-Seq v4 full-length transcriptome analysis kit from Takara (product # 634888) using protocol B specified in the manual on page 12 ...
-
bioRxiv - Zoology 2024Quote: ... PCR products were resolved by agarose gel electrophoresis with a DL2000 DNA Ladder (TaKaRa Bio, Dalian, China) before bands of the expected sizes were excised to remove primer dimers ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript, negative control pAMCyan1 from Takara), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA was isolated from samples using the RNAiso Plus (TAKARA, Japan). Detailed protocols were described in Supplementary Methods ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative real-time RT-PCR was performed with TB Green® Premix Ex Taq™ II (TAKARA, Japan) using a Bio-Rad CFX 96 real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and co-transfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Developmental Biology 2024Quote: ... A single Leu100Ala point mutation was introduced by In-Fusion cloning (Takara) to generate a pMT-BiP-TsgL100A:ALFA plasmid ...
-
bioRxiv - Immunology 2024Quote: ... 100ng of total RNA was used for cDNA synthesis by RNA to cDNA EcoDry™ Premix (Double Primed) kit (Takara), and qPCR was performed by Taqman primers with TaqMan™ Fast Advanced Master Mix (Applied Biosystems™ ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were prepared using the Ultra-low input RNA-seq Preparation Kit (Takara) as recommended by the manufacturer ...
-
bioRxiv - Immunology 2024Quote: ... 0.5mL T cells at 2 × 106 cells mL-1 were mixed with 1.5mL lentiviral supernatant and centrifuged in 24-well plates pre-coated with 7 µg mL-1 Retronectin (Takara Bio, San Jose, USA) at 1000 x g for 20min ...
-
bioRxiv - Immunology 2024Quote: ... with a SYBR Green mix (Takara and predesigned primers obtained from Sigma-Aldrich (KiCqStart® Primers) ...
-
bioRxiv - Physiology 2024Quote: ... and rat anti-E-cadherin (1:200, Takara Bio, M108). Next ...
-
bioRxiv - Microbiology 2024Quote: ... using In-Fusion technology (Takara) and Sanger sequenced by the in-house sequencing facility.
-
bioRxiv - Neuroscience 2024Quote: ... 10% tet-approved fetal bovine serum (tet-FBS) (Takara/Clontech, #631367), N2 (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 10% tet-approved fetal bovine serum (tet-FBS) (Takara/Clontech, #631367), N2 (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tetracycline-free fetal bovine serum (Takara Bio 631367) was used for experiments using the doxycycline-system ...