Labshake search
Citations for Takara Bio :
1051 - 1100 of 5321 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... and the RiboGone Low-Input Ribosomal RNA Removal Kit (Clontech). Library concentrations were measured using a Qubit 2.0 and library fragment sizes were measured using a Caliper Life Sciences LabChip GX ...
-
bioRxiv - Biochemistry 2019Quote: ... and ligated using a Blunting Kination Ligation Kit (Takara 6217). The mutated sequences of the ClpP1 gene were confirmed by DNA sequencing (Tsingke) ...
-
bioRxiv - Cancer Biology 2020Quote: ... with In-Fusion® HD Cloning Kit (Takara Bio, Inc.) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... PrimeScript II High Fidelity One step RT-PCR Kit (Takara) was used with the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... According to the BD Genome Walker Universal Kit (Clontech, USA) manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Cell-death was assayed using LDH Cytotoxicity Detection Kit (Takara). To normalize for spontaneous lysis ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplification was performed using Advantage GC 2 PCR kit (Clontech) and PCR products were cloned and sequenced.
-
bioRxiv - Microbiology 2020Quote: ... TAKARA Bio SMART-Seq Stranded Kit User Manual (TAKARA Bio) was used with the following modifications ...
-
bioRxiv - Microbiology 2020Quote: ... pseudotuberculosis were performed using an In-fusionHD cloning kit (Clontech) according to the manufacturer’s instructions ...
-
The evolution of red colour vision is linked to coordinated rhodopsin tuning in lycaenid butterfliesbioRxiv - Evolutionary Biology 2020Quote: ... We thereafter used the SMARTer RACE cDNA Amplification kit (Clontech) to prepare 5’- and 3’- RACE cDNA for each species ...
-
bioRxiv - Molecular Biology 2019Quote: ... we used PrimeScript RT reagent kit with gDNA Eraser (TAKARA) and superreal premix plus (SYBR Green ...
-
bioRxiv - Genetics 2021Quote: ... by using the In-Fusion HD Cloning Kit (Takara Bio).
-
bioRxiv - Plant Biology 2021Quote: ... and reverse transcribed RNA to cDNA by TransScript Kit (TaKaRa). The expression of CYP86A4 was detected by RT-PCR or quantitative RT-PCR using forward primer 5’-CCCCAAGGGTTTCACTGAATTC-3’ and reverse primer 5’-AAGTAAATGCGAAGCCTGCTTG −3’ and Applied Biosystem Step One real-time PCR system or TaKaRa SYBR Premix Ex Taq II reagent kit ...
-
bioRxiv - Physiology 2020Quote: ... and SYBR ® Premix Ex Taq™ II kit (Takara) were used for qRT-PCR target fragment ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated by RT Master reverse transcription kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the In-Fusion HD EcoDry cloning kit (Takara Bio), resulting in the plasmid pDriveΔsrtA ...
-
bioRxiv - Microbiology 2020Quote: ... First strand cDNA was synthesized using PrimeScript RT kit (TakaRa). Optimized ddPCR was used to detect the presence of SARS-CoV-2 viruses following our previous study.10 Analysis of the ddPCR data was performed with QuantaSoft software (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... The SMART-Seq Single Cell Kit (SSsc; Cat. # 634472, Takara) was used and reaction volumes were miniaturized 6 times with the aid of the Mosquito HV robot as per the kit provider User Guide (cDNA synthesis using the mosquito HV genomics with the SMART-Seq® Single Cell Kit ...
-
bioRxiv - Biochemistry 2021Quote: ... In-Fusion HD cloning kit (638909) was purchased from Takara. All enzymes and buffers used in cloning were purchased from New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected using the CalPhos Mammalian Transfection Kit (Clontech) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized using the PrimeScript RT reagent kit (Takara). Real-time quantitative PCR was performed in triplicate using the SYBR Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2021Quote: All Lenti-X products and kits were purchased from Takara Bio USA Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... In-Fusion cloning (In-Fusion HD Cloning Plus kit, Clontech) was used to fuse the sh1-resistant MFN2 fragment with the linearized backbone ...
-
bioRxiv - Genomics 2021Quote: The cDNAs were synthesized using SMARTScribe Reverse Transcription Kit (TaKaRa). Two pairs of primers that target either both exons b and c or exon b only were used to amplify these two exons ...
-
bioRxiv - Molecular Biology 2021Quote: ... pRev and pVSVG using CalPhos mammalian transfection kit (TaKaRa Clontech). Next day ...
-
bioRxiv - Molecular Biology 2021Quote: ... pRev and pVSVG using CalPhos mammalian transfection kit (TaKaRa Clontech). Next day ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was isolated using MN Nucleospin RNA kit (Takara). Equal quantities of RNA were reverse transcribed using Primescript Reverse transcriptase and random hexamers (Takara) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara). Quantification of transcripts was performed on a Mx3005P QPCR system (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... LA Taq HS DNA polymerase kit from TaKaRa (TaKaRa Bio) conveyed the best performance and was therefore further used ...
-
bioRxiv - Genomics 2021Quote: ... using the In-Fusion® HD Cloning Kit (Takara/Clonetech). For transfection of reporter plasmids ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was accomplished with Reverse Transcription Kit (Takara, RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... A high-fidelity Advantage HF2 PCR kit (Takara, Cat#639123) was used in each of the PCR steps involved in preparing the sequencing libraries ...
-
bioRxiv - Immunology 2022Quote: ... using an In-Fusion ligase-independent cloning kit (Takara-Clontech). The mCITED1 sequence was then subcloned into the pINDUCER20 lentiviral vector (a kind gift from the Weissmiller lab ...
-
bioRxiv - Immunology 2022Quote: ... using an In-Fusion ligase-independent cloning kit (Takara-Clontech). The mCITED1 sequence was then subcloned into the pINDUCER20 lentiviral vector (a kind gift from the Weissmiller lab ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral titers were measured using AAVpro Titration Kit (#6233, Takara) or THUNDERBIRD SYBR qPCR Mix (QPS-201 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were quantified using the Library quantification kit (Takara) and Thermal cycler Dice Realtime TP800 (Takara ...
-
bioRxiv - Developmental Biology 2022Quote: ... Following purification with Zymoclean Gel DNA Recovery Kit (ZD4008, Takara), product size distribution and quantity were assessed on a Bioanalyzer using an Agilent 2100 high-sensitivity DNA assay kit (5067-4626 ...
-
bioRxiv - Cell Biology 2022Quote: In-Fusion cloning (In-Fusion HD Cloning Plus Kit, Clontech) was used to fuse the fragments with the linearized backbone ...
-
bioRxiv - Genetics 2022Quote: ... The SMART-seq v4 Ultra Low input RNA kit (Clontech) was used to amplify cDNA ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesised using the PrimeScript II kit (Takara Bio). Total RNA and genomic DNA from A ...
-
bioRxiv - Microbiology 2022Quote: ... using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Real-time qPCR experiments were performed as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthesis of cDNA was performed using cDNA synthesis Kit (Takara). The qPCR was conducted on the Applied Biosystems instrument using the SYBR Green Master Mix ...
-
bioRxiv - Neuroscience 2023Quote: ... SMARTer Stranded Total Sample prep kit-HI Mammalian (Takara, 634875) was used to generate libraries for RNA sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... or PrimeSTAR Mutagenesis Basal kit (Takara Bio Inc., Shiga, Japan): Y156V ...
-
bioRxiv - Plant Biology 2022Quote: ... using an In-Fusion HD cloning kit (Clontech Laboratories, USA). Targeting vectors were introduced into F1 sporelings of M ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Plant Biology 2024Quote: ... or the SMART-Seq mRNA LP Kit (Takara Bio USA) (for pre-parasitic J2 library generation) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SYBR RT-PCR Kit was purchased from Takara (Dalian, China). PHrodo-labelled E ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...