Labshake search
Citations for Takara Bio :
9301 - 9350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... T cells were infected with either replication-competent HIV-1 (pAD8gNef [80] or pNLgNef [79] or single-round HIV-1 (pHR-CD8a-d2eGFP-IRES-Nef) using Lenti-X Accelerator (TaKaRa) following the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from RAW264.7 cells and ground cartilage from human tibial plateaus using TRIzol reagent (Takara Bio Inc., Shiga, Japan). For mRNA quantification ...
-
bioRxiv - Genomics 2022Quote: ... NPAS2 mRNA was quantified by qRT-PCR with SYBR Premix ExTaq (Applied Takara Bio, Baori Medical Biotechnology) and normalized to GAPDH as the reference gene.
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara).
-
bioRxiv - Genomics 2022Quote: ... Sublibraries were PCR amplified using primer-specific barcodes for each sublibraries and PrimeStar GXL DNA polymerase (Takara Bio) according to the manufacturer’s instructions in 50 µL reactions using 1µL of the total OLS library as template and 25 cycles of PCR ...
-
bioRxiv - Immunology 2022Quote: Retroviral vectors introducing individual XIRP1 isoforms were generated with pMSCVpuro (Clontech Laboratories, 631461). Since the XIRP1 coding region is entirely within exon 2 ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells were seeded in a 6-well plate at a density of 6 × 105 cells/well and co-transfected with pSIN-siU6 – shSLFN11/ shSLFN12/ shSc (2 μg) along with plasmids pGP (1 μg, Takara) and pPE ampho (1 μg ...
-
bioRxiv - Immunology 2022Quote: ... and pPE ampho (1 μg, Takara) using 12 μl of Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... WSSV copies was detected by qPCR analysis using Premix Ex Taq (Probe qPCR) (Takara, Japan) with WSSV primers (5’-TTGGTTTCATGCCCGAGATT-3’ ...
-
bioRxiv - Immunology 2022Quote: ... In vitro Transcription T7 Kit (Takara, China) was used to synthesize specific siRNAs targeting the above genes according to the user’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... followed by first-strand cDNA synthesis through PrimeScript RT Reagent Kit (Takara, Japan). Primers used were listed as follows ...
-
bioRxiv - Immunology 2022Quote: Total RNA of hemocytes was extracted by RNAiso Plus (Takara, Japan), followed by first-strand cDNA synthesis through PrimeScript RT Reagent Kit (Takara ...
-
bioRxiv - Immunology 2022Quote: ... The reactions were pooled and purified with the Nucleospin gel and PCR purification kit (Takara). The purified PCR product was analyzed 2% agarose gel and subjected to sequencing on a HiSeq4000 (Fulgent Genetics) ...
-
bioRxiv - Immunology 2022Quote: ... Transduction of 2.5×105 Jurkat cells was performed using Retronectin (Takara) binding according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... The day before transduction, a non-tissue culture treated 24-well plate (Grener Bio one, #662102) was coated with retronectin (Takara Bio, #T100B) in PBS (7μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... and reverse-transcribed to cDNA using PrimeScript RT reagent kit (TaKaRa Biotechnology). RT-PCR was performed with StepOnePlus (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... Retronectin (Takara Bio Cat#T100A), Sodium Pyruvate (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... cells were stimulated with indicated concentrations of B/B homodimerizer (Takara Bio) for 15 h ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed on three biological replicates using the Thermal Cycler Dice Real Time System TP-760 (Takara) with the Kapa SYBR fast universal qPCR kit (Kapa Biosystems) ...
-
bioRxiv - Plant Biology 2022Quote: ... USA using SYBR green chemistry (Takara, Japan) to validate 10 candidate AaCYP genes for their differential expression in infected Aquilaria wood and MeJ induced callus ...
-
bioRxiv - Plant Biology 2022Quote: ... and qRT-PCR was performed on the Thermal Cycler Dice® (TaKaRa) using SYBR® Premix EX Taq™ and gene-specific primers designed in this study (Table 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... According to the Yeast Protocols Handbook (Clontech), the activation domain (AD ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (Clontech) with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with PrimeSTAR® Max DNA Polymerase (R045B, TaKaRa) and previously established circAβ-a primers (circAβ-a-R1 and circAβ-a-F1)[44] for 40 cycles.
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was generated with a PrimeScript RT reagent kit (Takara Cat# RR047A). Quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... and pHelper plasmid (TAKARA). The supernatants were purified and concentrated in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA synthesis was performed with RNA to cDNA EcoDry Premix (Oligo dT) (Clontech). qPCR was performed with SsoFast EvaGreen Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... pcDNA3.1-DCCR1343H-HA (c.4028G>A, p.R1343H) was derived from pcDNA3.1-DCCWT-HA using In-Fusion (Clontech 639648). Next ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 10% FBS (Clontech, Mountain View, CA), 50 U/mL penicillin ...
-
bioRxiv - Molecular Biology 2022Quote: ... rAAVs were purified using AAVpro® Purification Kit for All Serotypes (Cat # 6666, Takara Bio USA, CA) and each of the purified rAAVs were tested in separate transwell BBB cultures with hCMEC/D3 cells and primary astrocytes at MOI of 1e4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries for RNA sequencing were prepared from 5 ng RNA/sample using the SMARTer Stranded Total RNA-Seq Kit v2 -Pico Input Mammalian (Takara) according to the manufacturer’s instructions using 12 PCR cycles for amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... The freshly extracted plasmids were transformed into yeast strain Y2H gold by using a yeast transformation kit (TaKaRa, Beijing, China) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4.1 μL of RNase A (20 mg/mL; Clontech, 740505) was added ...
-
bioRxiv - Genetics 2022Quote: ... Small DNA fragments were removed by spin-column chromatography with Chroma-Spin-1000+TE columns (Clontech) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... were subjected to RNA-seq library preparation using SMARTer Stranded Total RNA-Seq Kit – Pico Input Mammalian (Cat. No. 635005, TAKARA). All the libraries were analysed through a Bioanalyzer for quality control ...
-
bioRxiv - Genomics 2022Quote: ... for YAC/BACs <20 kb or using the Nucleobond XtraBAC kit (Takara 740436) for YAC/BACs >20 kb ...
-
bioRxiv - Immunology 2022Quote: ... and concentrated with Lenti-X concentrator (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... pmCherry-N’ (Clontech) between NheI and HindIII restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... An aliquot of 1 μg of the total RNA was used to synthesize cDNA using PrimeScript™ RT reagent Kit with gDNA eraser (Takara). qRT-PCR analysis was performed on a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... Total RNA was extracted using RNAiso (TAKARA, Japan), and genome DNA was digested with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... using the Infusion cloning kit (Takara). Ligations were transformed in DH5α cells plated on LB+ Kanamycin plates ...
-
bioRxiv - Microbiology 2022Quote: ... using SYBR Premix ExTaq (Takara, Shiga, Japan). The relative EPA6 expression level was normalized by comparison to the expression of 18S-rRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... library preparation (Nextera XT, Clontech), quantification (KAPA Library Quantification Kit Illumina ...
-
bioRxiv - Synthetic Biology 2022Quote: ... for Infusion Cloning (Takara Bio). Plasmids were transformed into chemically competent NEB Turbo E ...
-
bioRxiv - Plant Biology 2022Quote: ... in pGADT7 were combined with each other and with empty control plasmids using the Matchmaker™ Gold Yeast Two-Hybrid System (Clontech). The vectors were co-transformed into the Y2Hgold MATa Yeast strain ...
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (AtEH1_1-527_GBD_F GCCATGGAGGCCGAATTCCCAATGGCGGGTCAGAATCCTAACATGG and AtEH1_1-527_GBD_R CTGCAGGTCGACGGATCCCCTTATGCAGAATATCCATT ACCTAGGTGATTAGC) and cloned into the pGBKT7 vector (Clontech). The cytoplasmic part of CLV1 (AA 671 to 980 ...
-
bioRxiv - Plant Biology 2022Quote: ... and the Thermal Cycler Dice Real-Time System II (TaKaRa Biotechnology, Dalian, China) was used for real-time fluorescent qPCR analysis ...
-
bioRxiv - Plant Biology 2022Quote: ... and cloned into a linearized pENTR1A vector using In-fusion (Takara Bio). Inserts were transferred into pMpGWB104 vectors (Ishizaki et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 5,000 bp upstream sequences flanked the start codons of the MpSGFs were amplified from MpTak-1 genomic DNA using PrimeSTAR GXL polymerase (Takara Bio) and cloned into a linearized pENTR1A vector using In-fusion (Takara Bio) ...
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (CLV1_671-980_GAD_F GAGGCCAGTGAATTCCACCCACTCG CCTGGAAACTAACCGCCTTC and CLV1_671-980_GAD_R TCCCGTATCGATGCCC ACCCTTAGAACGCGATCAAGTTCGCCACGG) and cloned into pGADT7 (Clontech). Both vectors were generated via Gibson assembly following SmaI-dependent linearization of the vectors ...