Labshake search
Citations for Takara Bio :
7851 - 7900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized with the PrimeScript II 1st strand synthesis kit (Takara bio). RT-qPCR was performed with CFX connect (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... isolated the RNA from the last four fractions by RNAiso plus (Takara) kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... and/or mCherry (Living Colors DsRed Polyclonal Antibody #632496, Takara, Japan) after in situ hybridization were carried out as described in (Chen Q et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1%BSA and 10% FBS.Cells were incubated with anti-c-Myc antibody (Clontech Laboratories, USA) at a 1:10 dilution for 16 hr at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... or DL5000 (Takara, Dalian, China).
-
bioRxiv - Microbiology 2022Quote: ... along with Bsu36 I-digested BacPAK6 Viral DNA as described earlier (Takara Bio Inc., USA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... The titres of the generated baculovirus were determined using BacPAK Baculovirus rapid titre kit (Clontech, USA).
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Microbiology 2022Quote: ... Viruses were concentrated using the Lenti-X concentrator (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... then concentrated using the Lenti-X concentrator (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then cloned into the KpnI site of pUASt using InFusion technology (Clontech). The forward and reverse primers used to amplify LSSmKate2 are respectively GGCCGCGGCTCGAGGGTACCATGAGCGAGCTGATTAAGGAG and AAAGATCCTCTAGAGCTAATTAAGCTTGTGCCCCAGT ...
-
bioRxiv - Cell Biology 2022Quote: ... TurboGFP was exchanged for eGFP by amplifying the eGFP sequence by PCR from peGFP-N1 (Clontech) using the following primers to introduce AgeI and NotI restriction sites ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse monoclonal anti-GFP (Clontech; milk; 1:2,000).
-
bioRxiv - Systems Biology 2022Quote: ... and 2X KAPA HiFi Hot Start Ready Mix 15 μl (TaKaRa Bio Inc., Japan), via a two-stage PCR procedure with a thermal instrument (Applied Biosystems 9700 ...
-
bioRxiv - Immunology 2022Quote: ... cDNA generation and amplification were performed with SMART-Seq v4 ultra Low Input RNA kit (Takara Bio 634891). Amplified cDNA was purified using AMPure XP Beads (Beckman Coulter A63881) ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Plant Biology 2022Quote: DNA was amplified from cDNA by PCR using PrimeStar GXL DNA polymerase (Takara Bio, Shiga, Japan) and verified by DNA sequencing using a 3130 Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Site-directed mutagenesis in GC-A and GC-B and construction of chimeric receptors were performed through use of the In-Fusion HD plus cloning kit (Takara Bio Inc.). The primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2022Quote: AAV-PHP.eBs were packaged in AAVpro 293T cells (Clontech, 632273). Cells were harvested by cell lifter (Biologix ...
-
bioRxiv - Neuroscience 2022Quote: ... we used Rapalog (TaKaRa, Shiga, Japan, #635057).
-
bioRxiv - Plant Biology 2022Quote: ... the libraries were prepared by SMARTer Ultra Low Input RNA for Sequencing Kit (Clontech). The quality of each library was validated with a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... followed by PrimeScript™ RT Master Mix (Takara Bio, Otsu, Shiga, Japan) for cDNA synthesis in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... A high-fidelity Advantage HF2 PCR kit (Takara, Cat#639123) was used in each of the PCR steps involved in preparing the sequencing libraries ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: The inducible cell lines expressing WT or mutants of vimentin were established by the Tet-One Inducible Expression System (Clontech, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Purified RNAs were reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, JP) and the S gene was amplified using PrimeSTAR GXL DNA Polymerase (Takara ...
-
bioRxiv - Immunology 2022Quote: ... The reverse transcription was processed with PrimerScript RT Reagent Kit (TaKaRa) according to the manufacturers’ instructions ...
-
bioRxiv - Immunology 2022Quote: ... and the S gene was amplified using PrimeSTAR GXL DNA Polymerase (Takara, JP) for next-generation sequencing.
-
bioRxiv - Immunology 2022Quote: ... Purified RNAs were reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, JP) and the S gene was amplified using PrimeSTAR GXL DNA Polymerase (Takara ...
-
bioRxiv - Immunology 2022Quote: ... and the S gene was amplified using PrimeSTAR GXL DNA Polymerase (Takara, JP) for next-generation sequencing.
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Immunology 2022Quote: ... using TaqMan Universal (except for Sμ quantification we used SYBR green Mastermix (TAKARA)) on StepOnePlus system (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... All Lenti-X products were obtained from Takara-Clontech.
-
bioRxiv - Immunology 2022Quote: ... Lenti-X 293T packaging cells were obtained from Takara-Clontech and were cultured in DMEM supplemented with 10% tetracycline-free FBS (Takara-Clontech), 200 mM L-glutamine ...
-
bioRxiv - Immunology 2022Quote: ... Lenti-X 293T packaging cells were obtained from Takara-Clontech and were cultured in DMEM supplemented with 10% tetracycline-free FBS (Takara-Clontech), 200 mM L-glutamine ...
-
bioRxiv - Immunology 2022Quote: ... using an In-Fusion ligase-independent cloning kit (Takara-Clontech). The mCITED1 sequence was then subcloned into the pINDUCER20 lentiviral vector (a kind gift from the Weissmiller lab ...
-
bioRxiv - Immunology 2022Quote: ... The pINDUCER20-EYFP-mCITED1 lentiviral construct was produced by amplifying the full-length murine CITED1 coding sequence from pCDNA3-Flag-mCITED1 and subcloning it into pEYFP-C1 (Takara/Clontech) in-frame with the EYFP coding sequence ...
-
bioRxiv - Immunology 2022Quote: ... The pINDUCER20-EYFP-mCITED1 lentiviral construct was produced by amplifying the full-length murine CITED1 coding sequence from pCDNA3-Flag-mCITED1 and subcloning it into pEYFP-C1 (Takara/Clontech) in-frame with the EYFP coding sequence ...
-
bioRxiv - Immunology 2022Quote: ... Lenti-X 293T packaging cells were obtained from Takara-Clontech and were cultured in DMEM supplemented with 10% tetracycline-free FBS (Takara-Clontech) ...
-
bioRxiv - Immunology 2022Quote: ... using an In-Fusion ligase-independent cloning kit (Takara-Clontech). The mCITED1 sequence was then subcloned into the pINDUCER20 lentiviral vector (a kind gift from the Weissmiller lab ...
-
bioRxiv - Immunology 2022Quote: ... 0.5 × 106 cells were plated in a 24-well pre-coated with retronectin (Takara Bio). Virus-containing medium was concentrated by ultracentrifugation and added to cells for 8 h ...
-
bioRxiv - Microbiology 2022Quote: RNA isolation was performed from transfected cells / after appropriate hours of infection with STM WT at MOI of 10 using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed with Ex-Taq enzyme (TaKaRa) in a total volume of 30 µl containing 1 µl viral DNA ...
-
bioRxiv - Microbiology 2022Quote: ... following a commercial protocol (Takara Bio, San Jose, CA, USA). Once the amplified regions were purified and quantified by NanoDrop ND-10000 spectrophotometer (NanoDrop Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: We use a PCR amplification kit (Takara Bio, Japan) to obtain the purified dsDNA target and control with primers listed in Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Finally RNA was isolated from the eluates by phenol-chloroform-Isoamyl alcohol (25:24:1) pH 4.5 extraction and cDNA was prepared using 1st strand cDNA synthesis kit (Takara Bio Inc., Shiga, Japan) as described in above RNA analysis section ...
-
bioRxiv - Molecular Biology 2022Quote: ... Subsequent qPCR was performed using TB Green Premix Ex Taq II (Tli RNase H Plus) (TAKARA) with the RDN18-specific primers 5′-AACTCACCAGGTCCAGACACAATAAGG-3′ and 5′-AAGGTCTCGTTCGTTATCGCAATTAAGC-3′ ...
-
bioRxiv - Microbiology 2022Quote: Purified plasmids were transfected into HeLa 229 cells using the Xfect transfection reagent (Takara Biosciences) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... A tomato Mate & Plate library was constructed and used for screening with the Matchmaker Gold Yeast Two-Hybrid System (Clontech) according to the manufacturer’s instructions ...