Labshake search
Citations for Takara Bio :
651 - 700 of 5458 citations for Rat Insulin Like Growth Factor Binding Protein 4 IGFBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... library preparation was performed using the SMARTER Stranded Total RNA Seq kit v2-Pico Input Mammalian kit (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... chimeric fluorescence detection kit and TB Green Premix Ex Taq™ (Tli RNaseH Plus) kit were obtained from Takara Biomedical Technology (Beijng ...
-
bioRxiv - Zoology 2024Quote: ... and reverse transcribed using the PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) kit (Takara, Dalian, China). The RT-qPCR reactions were carried out on the PikoReal 96 Real-Time PCR System (Thermo ...
-
bioRxiv - Systems Biology 2022Quote: ... The blocked membrane was incubated overnight at 4 ℃ in primary antibodies: mouse polyclonal anti-Cas9 (Takara Bio, cat. no. 632607), mouse monoclonal anti-β-actin (8H10D10 ...
-
bioRxiv - Genomics 2019Quote: ... into individual wells of a 48-well plate (Brand) filled with 4 μl of a hypotonic lysis buffer containing 2 U/μL RNase inhibitor (Takara) and 0.2 % Triton-X-100 in Nuclease-free water ...
-
bioRxiv - Immunology 2020Quote: ... Transient retroviral supernatants were produced as previously described.44 Activated NK cells were purified and transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... Same volume of samples were loaded on 4-16% gradient SDS-PAGE gels and analyzed by western blot analysis using EGFP (JL-8; Clontech), penta-HIS (QIAGEN ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was annealed to primers by the addition of 4 µL 100 µM Random Hexamer Primers (TaKaRa, Mountain View, CA) and incubation at 65°C for 5 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... The libraries for RNA sequencing were generated using SMART-Seq v.4 Ultra Low Input RNA (Takara Bio, cat. #634890) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Biochemistry 2020Quote: ... After high speed centrifugation (40 000 x g/40 min/4 °C) the supernatant was loaded on to a gravity TALON metal affinity column (Takara), equilibrated and washed with 10 CV buffer A/20 mM imidazole ...
-
bioRxiv - Biochemistry 2020Quote: ... After high speed centrifugation (40 000 x g/40 min/4 °C) the supernatant was loaded on a HiTrap (GE) TALON Crude (Takara) metal affinity column ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Neuroscience 2019Quote: ... the slices were incubated overnight at 4°C with a rabbit polyclonal antibody against DsRed (1:1000, Takara Bio USA) diluted in a blocking solution of 0.3% Triton X-100 in PBS-DEPC ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.3% Triton X-100 in PBS and then stained with a primary antibody for 48 hours at 4°C with agitation in blocking buffer: DsRed (anti-rabbit, 1:5000, cat. number NC9580775, Takara), GFP (anti-chicken ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech, 632381 or anti-GFP.2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Then the nuclei were centrifuged at 500 x g for 5 minutes at 4°C and washed in 4 ml Nuclei Suspension Buffer (NBS; consisting of 1× PBS, 0.04% BSA and 0.1% RNase inhibitor (Clontech, Cat #2313A)) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Genetics 2020Quote: ... The beads were then suspended in TdT reaction buffer (1× NEBuffer #4, 0.25 mM CoCl2, 15 U TdT (Takara Bio), 20 Ci α-32P-dCTP [6000 Ci/mmol]) ...
-
bioRxiv - Neuroscience 2019Quote: ... 20μl cDNA solution per hemibrain was synthesised from 4-5g RNA using RNA-to-cDNA EcoDry Premix with random primers (Clontech), and was diluted 50-fold with distilled water.
-
bioRxiv - Neuroscience 2019Quote: ... In situ hybridization was followed by incubation at 4°C overnight with a rabbit anti-dsRed (1:3000, Clontech: 632475) primary antibody ...
-
bioRxiv - Microbiology 2020Quote: ... Different amounts of total RNA (4, 16, 32, or 40 ng) were used for first strand synthesis using SmartScribe RT (Clontech) and Oligo(dT)23 VN primer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... linearized pUCHCPV-20-4 was used as a template for in vitro transcription by T7 RNA polymerase (TaKaRa, Dalian, China) to generate chimeric HDAC11-S4 RNA 4 ...
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Neuroscience 2024Quote: ... and re-plated at a concentration of 2.5×105 cells/cm2 onto plates coated with 4 μg/mL iMatrix-511 (Takara Bio) in N2B27 medium supplemented with 10 μg/mL BDNF and 10 µg/mL Rock Inhibitor Y-27632 ...
-
bioRxiv - Systems Biology 2024Quote: SW1353 cells were purchased from ATCC Full length miRNA target 3’UTRs were amplified from human genomic DNA using PCR primers (Supplementary Table 4) to enable Clontech In-Fusion HD cloning (Takara Bio Europe ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were incubated overnight at 4°C in primary antibody diluted in PBS (1:100 monoclonal mouse anti-GFP; 632380, Clontech). After washing with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated overnight at 4°C with primary antibody diluted in blocking buffer (these were: 1:200 Living Colors Ab, #632380, Takara; 1:100 L-plastin ...
-
bioRxiv - Immunology 2023Quote: ... The RT reaction mixture was prepared on ice and contained (per sample): 4 µL SmartScribe 1st Strand 5X buffer (Takara), 2 µL 100 µM DTT (Takara) ...
-
bioRxiv - Plant Biology 2023Quote: ... transferred membranes were hybridized overnight at 4 °C with the following primary antibodies: anti-GFP (Takara Bio Cat# 632381, RRID:AB_2313808) (1/5000) ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reaction was prepared using gene-specific primers (20µM, Eurofins, primer sequences in Suppl. Table 4) and PrimeSTAR® Max DNA Polymerase (Takara) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2024Quote: ... The supernatant with the protein was then separated by ultracentrifugation (60,000 rpm, 45 min, 4°C) and incubated overnight with Talon metal affinity resin (Takara Bio). The protein was affinity purified from the solubilized fraction in a gravity column (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated overnight at 4°C in with primary antibodies Rabbit-anti-dsRed (1:200, Takara Bio Cat# 632496, RRID:AB_10013483) and Chicken-anti-GFP (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).