Labshake search
Citations for Takara Bio :
451 - 500 of 2806 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... MT-4 cells (gift from(Nakashima et al., 1990) were transfected with a plasmid containing LTR-driven EGFP expression plasmid (Clontech Laboratories Inc, USA) and pFX2 (Invitrogen Corporation ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Systems Biology 2020Quote: ... full length double stranded cDNA (dscDNA) was generated using the SMART-Seq version 4 Ultra Low Input kit (Takara Bio USA, Mountain View, CA) and the Nextera XT DNA Library Preparation kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... NK cells were transduced on day 4 of culture using transiently produced replication incompetent RD114 pseudotyped retroviral particles immobilized on RetroNectin (Clontech Laborotories, Palo Alto, CA).
-
bioRxiv - Molecular Biology 2022Quote: ... Section B step 4 in the protocol was modified to account for the incorporation of UDIs (Takara SMARTer RNA Unique Dual Index Kit-96A). A total of 2 uL of each UDI was used instead of the recommended 1 uL each of the 5’ and 3’ PCR primers ...
-
bioRxiv - Evolutionary Biology 2023Quote: SARS-CoV-2 cDNA was generated from 100 ng of RNA in a RT-PCR reaction buffer containing 4 μL of 5X PrimeScript IV 1st strand cDNA Synthesis Mix (Takara Bio, Kusatsu, Shiga, Japan), 2 μL of 50 μM random hexamer primer ...
-
bioRxiv - Cell Biology 2024Quote: ... and cloned into pCMV-HA-N or pCMV-HA-C (Clontech). Notably ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminally and subcloned into pMSCV-IRES-Thy 1.1 vector (Clontech) using EcoRI and ClaI restriction sites.
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: Hexa-histidine-tagged scaffolding protein (6 mg) was loaded on a 1 ml immobilized metal affinity chromatography column charged with cobalt (Clontech). Coat protein monomers (0.2 mg/ml ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Microbiology 2020Quote: ... using each of the following 4 restriction enzymes: HaeIII or Hha I or Rsa I or Alu I (10 units, Takara Bio Co. Ltd. Shiga, Japan) in buffer solution (10xLow salt buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein samples were run on a 4-12% Bis-Tris gel (Novex) and Western blots were performed with the following antibodies: α-GFP (Clontech Living Colors 632381 (JL-8); RRID:AB_2313808 ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl purified cDNA was amplified with an Advantage HF 2 PCR kit (Takara) in a 25 µl reaction containing 0.5 µl forward primer (10 µM ...
-
bioRxiv - Microbiology 2024Quote: ... encoding region at the 3’ terminus of a putative linearized ambi-like virus was done following the protocol of the SMARTer® RACE 5’/3’ Kit (Takara Bio USA, Mountain View, CA, USA), employing a specific primer designed by Primer3-2.3.7 under Geneious (Supplemental Table S2) ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Cell Biology 2021Quote: Interactions between CDK-2 and COSA-1 were assayed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech PT4084-1). CDK-2 and COSA-1 cDNAs were amplified from a C ...
-
bioRxiv - Cell Biology 2022Quote: ... FcγRIIA cDNA was cloned into a pEGFP-N vector (Takara Bio USA, CA). FTractin cDNA was fused with Halo tag in pTriEx-4 vector (Millipore Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 3′-RACE CDS primer (ClonTech) for cDNA synthesis from 5,4 μL uf viral RNA ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...