Labshake search
Citations for Evrogen :
1 - 50 of 77 citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... OneTube RT-PCR SYBR kit (Evrogen) was used for cDNA production by reverse transcription followed by qPCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of PCR reagents Master-mix ScreenMix HS (Evrogen, Russia), 5xMasCFGTaqMIX-2025 (unstained ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-PCR was performed with Taq polymerase (Evrogen, Russia) or Phusion High-Fidelity DNA polymerase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription was performed with random hexamer primers using the MMLV RT kit (Evrogen, Russia). The obtained cDNA was used as a template in RT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA for qRT-PCR was synthesized using an MMLV RT Kit (Evrogen, Russia) according to the manufacturer’s recommendations employing oligo(dT)17 -primers from 2 μg total RNA after DNase treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... Gene expression was measured by RT-qPCR using the customised primers (500nmol/L each, Evrogen, Moscow, Russian Federation, Table S5), cDNA (20ng ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reverse transcription reaction was performed using reagents for RT with an OT-Random primer (Agrodiagnostika) and a kit of reagents MMLVRTkit (Evrogen, Russia), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: The following primers and a probe were used for real-time PCR (synthesis at Evrogen, Russia):
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative real time RT–PCR was performed using Evrogen 5x qPCR mix-HS SYBR (Evrogen, #PK147L). Primers (Table 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... for reverse transcription (MMLV RT kit) and for real time PCR (HS SYBR kit) were obtained from Evrogen, Russia ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the number of molecules in each library was validated by real-time PCR using 2.5x Reaction mixture for PCR-RV in the presence of EVA Green (SINTOL, Russia) and primers for Illumina adapters (Evrogen, Russia). Further ...
-
bioRxiv - Plant Biology 2020Quote: Amplification of TALE genes was performed via a two-step PCR process in conjunction with primers 5’-GATCCCATTCGTTCGCGCACACCAAGTC-3’ and 5’-CTCCATCAACCATGCGAGCTCCTCTTCG-3’ and Taq DNA polymerase (Evrogen, Russia) under the following conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... a DNA fragment containing the hepatitis A virus 3C protease (3Cpro) gene with EcoRI and KpnI sites was generated by PCR using the primers GACTGAATTCGCCACCATGTCAACTCTAGAAATAGCAGG and CAACGGTACCTTACTGACTTTCAATTTTCTTATCAATG (Evrogen, Russia), and pBI-EGFP-3C [11] as the template ...
-
bioRxiv - Microbiology 2020Quote: ... The quantitative RT-PCR experiments were performed in triplicates on two independently grown colonies for each isolate in the sample with the use of OneTube RT-PCR SYBR Kit (Evrogen, Russia). The reactions were carried out on CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA fragment encoding the RBDv1 ORF with Kozak consensus sequence and C-terminal c-myc and 6xHis tags were obtained by PCR using primers AD-COV-AbsF and AD-RBD-myc6HNheR (listed in Table 1) and Tersus polymerase mix (Evrogen, Moscow, Russia). Synthetic oligo’s ...
-
bioRxiv - Immunology 2021Quote: ... Primers and probes were designed in NIH Primer BLAST and synthesis was performed by Evrogen (Moscow, Russian Federation).
-
bioRxiv - Biochemistry 2020Quote: ... All primers were synthesized by Evrogen (Russia); their sequences are listed in Supplemental Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... Primers (S1 Table) were purchased from Evrogen. Plasmids and genetic modifications of the E ...
-
bioRxiv - Biochemistry 2020Quote: ... Primers and qPCRmix-HS SYBR reaction mixture (Evrogen) and iCycler iQ thermocycler (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 μl of each primer (0.3 μM) (Evrogen, Russia), 18 μl of ddH2O (PanEko ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was synthesized using the MMLV RT kit (Evrogen) with random decanucleotide primers ...
-
bioRxiv - Genomics 2022Quote: Reverse transcription was performed using MMLV RT kit (Evrogen SK021). The synthesis was primed with oligo(dT) ...
-
bioRxiv - Plant Biology 2022Quote: cDNA was synthesized using the MMLV RT kit (Evrogen, Russian) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... DNA primer synthesis and DNA sequencing were performed by Evrogen (Russia). For the list of primers used in the study refer to Table S1 ...
-
bioRxiv - Biochemistry 2023Quote: ... RT-qPCR assays were performed with qPCRmix-HS SYBR kit (Evrogen), using the cDNA preparations as templates and 5’-GCAAGCGCATTTCAAGGAC / 5’-CCAGCGGGTGAAGTTCGTAG as primer pair for crdB ...
-
bioRxiv - Developmental Biology 2023Quote: ... qRT-PCR was then performed with SYBR PCR Mix (Evrogen) using the Thermal Cycler system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reverse transcription was performed using a MMLV RT kit (SK021, Evrogen, Russia) and random hexamer primers ...
-
bioRxiv - Biochemistry 2022Quote: ... RT-qPCR assays were done with the qPCRmix-HS SYBR kit (Evrogen), using the cDNA preparations as templates and 5’-CGGCGCAAACACATACCT / 5’-GCCCGGTTGTTCAATCTCT as primer pair ...
-
bioRxiv - Plant Biology 2023Quote: ... The reaction was performed using the MMLV RT kit (Evrogen, Moscow, Russia) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... RT-qPCR assays were performed with a qPCRmix-HS SYBR kit (Evrogen), using the cDNA preparations as templates and A1/A2 and D3/D4 primer pairs (Table S1 ...
-
bioRxiv - Genomics 2022Quote: ... The lack of detectable DNA in the DNase-treated samples was confirmed by qPCR assay (QuantumDNA-Set, Evrogen QS004). RNA concentrations were measured using Qubit™ RNA HS Assay Kit (Invitrogen Q32852).
-
bioRxiv - Cancer Biology 2023Quote: ... PCR reactions were conducted in duplicate with the Encyclo Plus PCR kit (Evrogen, # PK101) on a T100 Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
bioRxiv - Immunology 2021Quote: Tersus Plus PCR Kit (Evrogen) was used for all amplification procedures ...
-
bioRxiv - Genomics 2020Quote: Encyclo PCR Kit (Evrogen, Russia) was used for the evaluation of the transposable element analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mcg of total RNA was used for reverse transcription with MMLV-RT kit (Evrogen) according to the recommended protocol with oligo(dT)15 and random (dN)10 primers at a ratio of 1:3 ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR reaction was conducted using a high-precision polymerase Tersus Plus PCR kit (Evrogen, Moscow, Russia) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The RNA from each sample was then converted to cDNA using the MMLV RT kit (Evrogen, Russia) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: An expression vector for the C-terminal 6×His-tagged ARD protein was constructed by amplifying the ard gene (GenBank Gene ID: 57822953) by PCR with a high fidelity Tersus PCR kit (Evrogen) and the primer pair 5’-GAGGAATAAATTTATGGCTCAGTTAGTCGAT / 5’-GGAAACAAGATCAGATGCACTCTC using the genomic DNA of V ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR product and vector pTurboGFP-N (Evrogen) were digested with XhoI and HindIII purified and ligated to generate pGADD34-TurboGFP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Using the Tersus Plus PCR kit (Evrogen, PK221), blunting of the protruding ends in combination with A-tail treatment was performed ...
-
bioRxiv - Cell Biology 2019Quote: ... TagRFP fragment without start codon was obtained by PCR with TagRFP-woATG-F 5’-GT CGGTACCGTGTCTAAGGGCGAAGAGCTG-3’ n BFPX3-R 5’-GCGCTTAAGTTAATTAAGCTTGTGCCCCA-3’ primers and pTagRFP-N vector (Evrogen) as a DNA source ...
-
bioRxiv - Immunology 2021Quote: ... the corresponding gene was amplified with the use of the №17/№34 primer pair and purified with Cleanup Standard Kit (Evrogen). The obtained construct and intact PCS2+ vector were incubated with ClaI and XbaI FastDigest™ enzymes in the corresponding buffer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA for qPCR was synthesized using random primers and the First Strand cDNA synthesis kit (MINT Reverse Transcriptase, Evrogen, Russia) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: The first strand of cDNA was synthesized from a single-stranded RNA template using the MMLV RT kit (Evrogen, Russia) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized by random priming from 1 μg of total RNA using the MMLV RT kit (Evrogen, Moscow, Russia). These samples were subjected to qPCR using CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR was performed with Taq polymerase (PK113S, Evrogen, Russia) or Phusion High-Fidelity DNA polymerase (F530S ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCRs were done with Encyclo DNA polymerase (Evrogen, Moscow) and the AR9 genomic DNA as a template ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR was performed using qPCRmix-HS SYBR (Evrogen, Russia) and the Light Cycler 480 real-time PCR system (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... smegmatis genomic DNA by using Tersus Plus PCR kit (Evrogen) with primers (−47 ...