Labshake search
Citations for Evrogen :
1 - 50 of 104 citations for Plant DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA bands were excised with subsequent purification of PCR products using a Cleanup Standard Kit (Evrogen, BC022). Restriction enzymes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or obtained by purification of salt method extracted DNA (Aljanabi & Martinez, 1997) using CleanUp Standard kit (Evrogen, Moscow). The dsDNA quantity was measured using dsDNA HS Assay Kit for fluorometer Qubit 3 (Life Technologies ...
-
bioRxiv - Bioengineering 2019Quote: ... the ligation mixture was purified on Cleanup Mini DNA purification columns (Evrogen). 40 μl of electrocompetent cells were thawed on ice ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... This suspension was subjected to the DNA isolation by ExtractDNA Blood kit (Proteinase K plus SDS based lysis and silica-membrane purification; Evrogen, Russia), according to the manufacturer protocol.
-
bioRxiv - Plant Biology 2023Quote: ... After purification using the Cleanup Standard kit (Evrogen, Moscow, Russia), the restriction products were ligated using T4 ligase (Evrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... smegmatis genomic DNA by using Tersus Plus PCR kit (Evrogen) with primers (−47 ...
-
bioRxiv - Bioengineering 2019Quote: DNA amplification was performed using the Encyclo PCR Kit (Evrogen) on a PTC-200 Thermal Cycler (MJ Research) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid DNA for transfection was isolated using Plasmid Miniprep Kit (Evrogen, Russia) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and samples of animal and plant tissues “RNA-EXTRAN” from SINTHOL and “ExtraRNA” from Evrogen. For additional purification of the resulting RNA ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid DNA was isolated using the Plasmid Miniprep/BC021S kit (Evrogen, Russia). The bla gene sequence and pblaTEM plasmid type were confirmed by PCR and Sanger sequencing.
-
bioRxiv - Immunology 2021Quote: Phagemid DNA was isolated from bacterial cells using the Plasmid miniprep kit (Evrogen, Russia). VHH-coding sequences were sequenced with Lac-prom (5’-CTTTATGCTTCCGGCTCGTATG-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Uncleaved DNA fragments were extracted from the gel using the Cleanup Standard kit (Evrogen, BC04). These fragments were used as the templates for two-step PCR ...
-
bioRxiv - Microbiology 2022Quote: ... DNA primer synthesis and DNA sequencing were performed by Evrogen (Russia). For the list of primers used in the study refer to Table S1 ...
-
bioRxiv - Immunology 2021Quote: ... the target product was separated from the nontarget byproducts with horizontal DNA electrophoresis in agarose gel and purified with Cleanup Standard Kit (Evrogen). To engineer pQE30-NemR-cpYFP plasmids ...
-
bioRxiv - Genomics 2022Quote: ... and Taq DNA polymerase (Evrogen PK113L). The ligation step involved T4 DNA ligase (SibEnzyme E320) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCRs were done with Encyclo DNA polymerase (Evrogen, Moscow) and the AR9 genomic DNA as a template ...
-
bioRxiv - Biophysics 2022Quote: ... All DNA sequences were verified by Sanger sequencing (Evrogen JSC). Sequences of all primers used in this work are listed in Supplementary Table 5.
-
bioRxiv - Biochemistry 2020Quote: ... Obtained DNA was purified and cloned into pKAN-T (Evrogen) vector that was subsequently sequenced ...
-
bioRxiv - Developmental Biology 2023Quote: ... the TagCFP DNA fragment was amplified from pTagCFP-N (Evrogen) by PCR with the primers 5′-GAAGATCTATAACTTCGTATAGCATACATTATACGAAGTTATACCGGTCGCC ACCATGAGCG-3′ and 5′-CCGGAATTCCGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATACCACAACTAGAATGCAGTG-3′ ...
-
bioRxiv - Immunology 2021Quote: ... ScreenMix Kit (Evrogen) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid and chromosomal DNAs were isolated with Plasmid Miniprep (Evrogen, Russia) and PurElute Bacterial Genomic Kit (Edge BioSystems ...
-
bioRxiv - Immunology 2021Quote: ... and ligated with T4 DNA ligase in the corresponding buffer (Evrogen) at 14°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: The AstaP construct was verified by DNA sequencing (Evrogen, Moscow, Russia) and used to transform chemically competent cells ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic oligonucleotides were produced and DNA sequencing was performed by Evrogen (Russia). Isotope labels (2H ...
-
bioRxiv - Pathology 2020Quote: ... Quick-TA kit (Evrogen JSC) was used for cloning ...
-
bioRxiv - Immunology 2021Quote: Tersus Plus PCR Kit (Evrogen) was used for all amplification procedures ...
-
bioRxiv - Genomics 2020Quote: Encyclo PCR Kit (Evrogen, Russia) was used for the evaluation of the transposable element analysis ...
-
bioRxiv - Cancer Biology 2023Quote: ... OneTube RT-PCR SYBR kit (Evrogen) was used for cDNA production by reverse transcription followed by qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA molecules corresponding to the rRNA transcripts were depleted using the duplex-specific nuclease (Evrogen), as described elsewhere (42) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA fragments encoding M9M and Bimax2 peptides were inserted into the pTagRFP-C vector (Evrogen).
-
bioRxiv - Cell Biology 2021Quote: ... for reverse transcription (MMLV RT kit) and for real time PCR (HS SYBR kit) were obtained from Evrogen, Russia ...
-
bioRxiv - Immunology 2021Quote: ... The lack of any undesired mutations in the engineered genes was established by DNA sequencing (Evrogen).
-
bioRxiv - Molecular Biology 2021Quote: ... with a Screen Mix-HS polymerase kit (Evrogen). Amplifications were performed using a S1000™ thermal cycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel-purified using the Cleanup Standard kit (Evrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel-purified using the Cleanup Standard kit (Evrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was isolated using the ExtractRNA kit (Evrogen). RNA concentration was determined using a Nanodrop One C spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... woodyi cells using an RNA Solo kit (Evrogen) and additionally digested with RNase-free DNase I (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Using the Tersus Plus PCR kit (Evrogen, PK221), blunting of the protruding ends in combination with A-tail treatment was performed ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted using the ExtractRNA kit (Evrogen, Russia), the quality and quantity of preparations of total RNA and RNA from polysomal and monosomal fractions of plants was evaluated on an Agilent Bioanalyzer 2100 ...
-
bioRxiv - Plant Biology 2020Quote: ... thermocycler using the ScreenMix-HS kit (Evrogen, Moscow, Russia). The PCR cycling conditions were as follows ...
-
bioRxiv - Zoology 2019Quote: RNA extraction was performed using a ExtractRNA kit (Evrogen). An Agilent Technologies 2100 Bioanalyzer or 2200 TapeStation were used to establish that the RNA Integrity Number (RIN ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were normalized using the Evrogen Trimmer kit (Evrogen). Libraries were sequenced as 50 bp single-end reads at the Emory University genomics core facility using Illumina GAIIX ...
-
bioRxiv - Genomics 2020Quote: Normalization was done using Trimmer Kit (Evrogen, Moscow, Russia). One μg pooled GBS library in 12 μl was mixed with a 4 μl 4x hybridization buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was synthesized using the MMLV RT kit (Evrogen) with random decanucleotide primers ...
-
bioRxiv - Genomics 2022Quote: ... The lack of detectable DNA in the DNase-treated samples was confirmed by qPCR assay (QuantumDNA-Set, Evrogen QS004). RNA concentrations were measured using Qubit™ RNA HS Assay Kit (Invitrogen Q32852).
-
bioRxiv - Molecular Biology 2022Quote: ... The relative abundance of transcripts was estimated using quantitative real-time PCR with Hot Start DNA polymerase (Evrogen, Russia) and SYTO@ 13 green fluorescent nucleic acid stain (Life Technologies ...
-
bioRxiv - Genomics 2022Quote: Reverse transcription was performed using MMLV RT kit (Evrogen SK021). The synthesis was primed with oligo(dT) ...
-
bioRxiv - Biochemistry 2020Quote: ... First strand of cDNA was synthesized using Mint kit (Evrogen) with primers for k-chain (TTG TCG TTC ACT GCC ATC AAT C) ...
-
bioRxiv - Immunology 2021Quote: ... The restricted polynucleotides were purified with Cleanup Standard Kit (Evrogen) and ligated with T4 DNA ligase in the corresponding buffer (Evrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A custom normalization step (based on the EVROGEN Trimmer kit) was optimized in collaboration with the Roche R&D department and applied to the cDNA libraries ...