Labshake search
Citations for Evrogen :
1 - 40 of 40 citations for DNA Standards since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Uncleaved DNA fragments were extracted from the gel using the Cleanup Standard kit (Evrogen, BC04). These fragments were used as the templates for two-step PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA bands were excised with subsequent purification of PCR products using a Cleanup Standard Kit (Evrogen, BC022). Restriction enzymes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or obtained by purification of salt method extracted DNA (Aljanabi & Martinez, 1997) using CleanUp Standard kit (Evrogen, Moscow). The dsDNA quantity was measured using dsDNA HS Assay Kit for fluorometer Qubit 3 (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... the target product was separated from the nontarget byproducts with horizontal DNA electrophoresis in agarose gel and purified with Cleanup Standard Kit (Evrogen). To engineer pQE30-NemR-cpYFP plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel-purified using the Cleanup Standard kit (Evrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel-purified using the Cleanup Standard kit (Evrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The restricted polynucleotides were purified with Cleanup Standard Kit (Evrogen) and ligated with T4 DNA ligase in the corresponding buffer (Evrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... the samples were repurified using CleanRNA Standard (Evrogen, Moscow, Russia). cDNA was synthesized by random priming from 1 μg of total RNA using the MMLV RT kit (Evrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... After purification using the Cleanup Standard kit (Evrogen, Moscow, Russia), the restriction products were ligated using T4 ligase (Evrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragment was purified using a Cleanup Standard kit (Evrogen, Russia), digested with EcoRI and KpnI enzymes (SibEnzyme ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The PCR product was extracted using the Cleanup Standard kit (Evrogen, BC022S), and then treated with T4 polynucleotide kinase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR fragments were gel-extracted using the Cleanup Standard kit (Evrogen, BC04) and sequenced using were sequenced using NovaSeq 6000 with 300 paired-end cycles.
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR fragments were gel-extracted using the Cleanup Standard kit (Evrogen, BC04) and sequenced using Illumina NextSeq ...
-
bioRxiv - Physiology 2023Quote: ... Total RNA was extracted by a silica spin column (CleanRNA Standard, Evrogen, Russia); RNA concentration was evaluated by a fluorimetric assay (Qubit 4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the resulting product was cleaned from 2% agarose gel by Cleanup Standard Kit (Evrogen), digested by MluI and HindIII and ligated into pMV306/MluI ...
-
bioRxiv - Microbiology 2022Quote: ... DNA primer synthesis and DNA sequencing were performed by Evrogen (Russia). For the list of primers used in the study refer to Table S1 ...
-
bioRxiv - Immunology 2021Quote: ... the corresponding gene was amplified with the use of the №17/№34 primer pair and purified with Cleanup Standard Kit (Evrogen). The obtained construct and intact PCS2+ vector were incubated with ClaI and XbaI FastDigest™ enzymes in the corresponding buffer (Thermo Scientific ...
-
bioRxiv - Genomics 2022Quote: ... and Taq DNA polymerase (Evrogen PK113L). The ligation step involved T4 DNA ligase (SibEnzyme E320) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCRs were done with Encyclo DNA polymerase (Evrogen, Moscow) and the AR9 genomic DNA as a template ...
-
bioRxiv - Biophysics 2022Quote: ... All DNA sequences were verified by Sanger sequencing (Evrogen JSC). Sequences of all primers used in this work are listed in Supplementary Table 5.
-
bioRxiv - Molecular Biology 2021Quote: ... smegmatis genomic DNA by using Tersus Plus PCR kit (Evrogen) with primers (−47 ...
-
bioRxiv - Biochemistry 2020Quote: ... Obtained DNA was purified and cloned into pKAN-T (Evrogen) vector that was subsequently sequenced ...
-
bioRxiv - Bioengineering 2019Quote: DNA amplification was performed using the Encyclo PCR Kit (Evrogen) on a PTC-200 Thermal Cycler (MJ Research) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the TagCFP DNA fragment was amplified from pTagCFP-N (Evrogen) by PCR with the primers 5′-GAAGATCTATAACTTCGTATAGCATACATTATACGAAGTTATACCGGTCGCC ACCATGAGCG-3′ and 5′-CCGGAATTCCGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATACCACAACTAGAATGCAGTG-3′ ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid and chromosomal DNAs were isolated with Plasmid Miniprep (Evrogen, Russia) and PurElute Bacterial Genomic Kit (Edge BioSystems ...
-
bioRxiv - Immunology 2021Quote: ... and ligated with T4 DNA ligase in the corresponding buffer (Evrogen) at 14°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: The AstaP construct was verified by DNA sequencing (Evrogen, Moscow, Russia) and used to transform chemically competent cells ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic oligonucleotides were produced and DNA sequencing was performed by Evrogen (Russia). Isotope labels (2H ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid DNA for transfection was isolated using Plasmid Miniprep Kit (Evrogen, Russia) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... the ligation mixture was purified on Cleanup Mini DNA purification columns (Evrogen). 40 μl of electrocompetent cells were thawed on ice ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid DNA was isolated using the Plasmid Miniprep/BC021S kit (Evrogen, Russia). The bla gene sequence and pblaTEM plasmid type were confirmed by PCR and Sanger sequencing.
-
bioRxiv - Immunology 2021Quote: Phagemid DNA was isolated from bacterial cells using the Plasmid miniprep kit (Evrogen, Russia). VHH-coding sequences were sequenced with Lac-prom (5’-CTTTATGCTTCCGGCTCGTATG-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA molecules corresponding to the rRNA transcripts were depleted using the duplex-specific nuclease (Evrogen), as described elsewhere (42) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA fragments encoding M9M and Bimax2 peptides were inserted into the pTagRFP-C vector (Evrogen).
-
bioRxiv - Immunology 2021Quote: ... The lack of any undesired mutations in the engineered genes was established by DNA sequencing (Evrogen).
-
bioRxiv - Genomics 2022Quote: ... The lack of detectable DNA in the DNase-treated samples was confirmed by qPCR assay (QuantumDNA-Set, Evrogen QS004). RNA concentrations were measured using Qubit™ RNA HS Assay Kit (Invitrogen Q32852).
-
bioRxiv - Molecular Biology 2022Quote: ... The relative abundance of transcripts was estimated using quantitative real-time PCR with Hot Start DNA polymerase (Evrogen, Russia) and SYTO@ 13 green fluorescent nucleic acid stain (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: The plasmid expressing phoP and phoQ was constructed by cloning the PCR fragment amplified with the Tersus DNA polymerase (Evrogen) and the phoPQf1 and phoPQr primers into the low copy number vector pZH449.
-
bioRxiv - Evolutionary Biology 2019Quote: ... This suspension was subjected to the DNA isolation by ExtractDNA Blood kit (Proteinase K plus SDS based lysis and silica-membrane purification; Evrogen, Russia), according to the manufacturer protocol.
-
bioRxiv - Plant Biology 2020Quote: Amplification of TALE genes was performed via a two-step PCR process in conjunction with primers 5’-GATCCCATTCGTTCGCGCACACCAAGTC-3’ and 5’-CTCCATCAACCATGCGAGCTCCTCTTCG-3’ and Taq DNA polymerase (Evrogen, Russia) under the following conditions ...