Labshake search
Citations for Evrogen :
1 - 50 of 75 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... TagRFP fragment without start codon was obtained by PCR with TagRFP-woATG-F 5’-GT CGGTACCGTGTCTAAGGGCGAAGAGCTG-3’ n BFPX3-R 5’-GCGCTTAAGTTAATTAAGCTTGTGCCCCA-3’ primers and pTagRFP-N vector (Evrogen) as a DNA source ...
-
bioRxiv - Microbiology 2021Quote: ... pTAG-BFP-N (Evrogen, FP172) was used.
-
bioRxiv - Molecular Biology 2021Quote: ... or TagGFP2 (pTagGFP2-N vector, Evrogen) were used as controls for the crosstalk of the TagGFP2 signal into the red channel and the Katushka signal into the green channel ...
-
bioRxiv - Cell Biology 2023Quote: ... with BFP from pTagBFP-N Vector (Evrogen) at EcoRI/XbaI) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and cloned into TagRFP-AS-N vector (Evrogen). The SsPrx03 and SsPrx03m1-TagRFP C-terminal fusion was then subcloned (LR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR product and vector pTurboGFP-N (Evrogen) were digested with XhoI and HindIII purified and ligated to generate pGADD34-TurboGFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells expressing either Katushka (pTurboFP635-N vector, Evrogen) or TagGFP2 (pTagGFP2-N vector ...
-
bioRxiv - Microbiology 2019Quote: ... the TagGFP2 sequence of the pTagGFP2-N vector (Evrogen) was amplified via PCR (5’-ATAAGAATTCCGGAATGAGCGGGGGCGAGGAG and 5’-CGGGGAATTCCATATGTTACCTGTACAGCTC primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Red fluorescent protein expression vector pTagRFP-N were from Evrogen, Moscow ...
-
bioRxiv - Developmental Biology 2022Quote: ... mKate2 was amplified from the pmKATE2-N plasmid from Evrogen introducing flanking B2 and BamHIXhoI-B3 sequences and cloned into pGEM-T Easy ...
-
bioRxiv - Developmental Biology 2023Quote: ... the TagCFP DNA fragment was amplified from pTagCFP-N (Evrogen) by PCR with the primers 5′-GAAGATCTATAACTTCGTATAGCATACATTATACGAAGTTATACCGGTCGCC ACCATGAGCG-3′ and 5′-CCGGAATTCCGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATACCACAACTAGAATGCAGTG-3′ ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway® TagRFP-AS-N entry clone (Evrogen). The PRX62-TagRFP fusion was subcloned (Gateway Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The fragment encoding tagRFP was PCR-amplified from pTagRFP-N (Evrogen). The fragments of ftsZ ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-Tag(CGY)FP (1:2000 in 0.5% milk TBST, 4°C o/n, Evrogen AB121). Blots were then incubated with IRDye 800/680 conjugated antibodies (1:10000 in 5% milk TBST ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... mIBP83 fragment of pEX-A2-SBP-T plasmid was subcloned into pTagGFP2-N vector (Evrogen) by PCR with the primers
-
bioRxiv - Molecular Biology 2020Quote: ... Cytosolic expression was facilitated by expression of free Padron2 inserted into the TagRFP-N vector (Evrogen, Moscow, Russia) with enzymes AgeI and NotI ...
-
bioRxiv - Cell Biology 2022Quote: ... EB1-TagRFP was generated by PCR amplification from KAZUSA cDNA (NCBI AB463888) and inserted into pTagRFP-N (Evrogen). The shRNA target sequence was designed for protein knockdown using the BLOCK-iT RNAi Designer tool (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... VE-cad constructs were subcloned between BamHI and AgeI restriction sites in Gateway TagRFP-AS-N (Evrogen, Farmingdale, NY), in-frame with monomeric C-terminal RFP ...
-
bioRxiv - Cell Biology 2019Quote: ... and SacI/PstI for the pTag-BFP-N to obtain pLEA-BFP (all plasmid backbones were from Evrogen, Milano, Italy). Correct clones were confirmed by Sanger sequencing using ABI PRISM 3100 (Applied Biosystem).
-
bioRxiv - Neuroscience 2020Quote: The caldendrin-tagRFP constructs were made by amplifying full length or caldendrin fragments from the pcDNA3.1/caldendrin vector and pasting them into the tagRFP-N plasmid (Evrogen, #FP142) using EcoRI and BamHI restriction and ligation.
-
bioRxiv - Plant Biology 2024Quote: ... except for the PCR fragments to make the proLecRK-I.9::LecRK-I.9::tagRFP and the proLecRK-I.9::LecRK-I.9Δkinase::tagRFP constructs which were inserted between the EcoRI and BamHI sites of the Gateway® tagRFP-AS-N entry vector (Evrogen, Moscow, Russia). After each transformation of Escherichia coli ...
-
bioRxiv - Biophysics 2021Quote: ... with the mutation C85A and C-terminal 6×His tag) was obtained as a synthetic gene from Evrogen (Russia) and introduced into the pET11 expression vector (Novagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 µl of dATP (10 mM) and 1 µl Encyclo polymerase (Evrogen, Moscow, Russia). The mixture was incubated at 37°C for 30 minutes followed by 5□min at 72□°C ...
-
bioRxiv - Plant Biology 2020Quote: Amplification of TALE genes was performed via a two-step PCR process in conjunction with primers 5’-GATCCCATTCGTTCGCGCACACCAAGTC-3’ and 5’-CTCCATCAACCATGCGAGCTCCTCTTCG-3’ and Taq DNA polymerase (Evrogen, Russia) under the following conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used rabbit polyclonal Anti-tRFP and Anti-TurboGFP(d) antibodies (Evrogen, Russia) diluted at 1:7000 ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: 3) The coding sequence of the Tag-BFP (from pTag_BFP-Actin, Evrogen) borded with 2 XhoI sites ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 μl of each primer (0.3 μM) (Evrogen, Russia), 18 μl of ddH2O (PanEko ...
-
bioRxiv - Genomics 2023Quote: ... 2μl of 50x dNTP (10 μM) (Evrogen, Moscow, Russia); 10μl of 10x Encyclo buffer (Evrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... pre-washed cells were lysed in x1 Laemmli buffer and analyzed with one-dimensional PAGE followed by western blotting using Anti-TurboGFP(d) antibodies (Evrogen, Russia).
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (goat a-ChAT Millipore AB144P 1:200 and chicken a-RFP Rockland 600-901-379 1:1000 or rabbit a-tRFP Evrogen AB233 1:1000) were prepared in light blocking solution (3% NDS ...
-
bioRxiv - Developmental Biology 2021Quote: ... TagRFP (1: 1000, Evrogen, AB233), GFP (1 ...
-
bioRxiv - Neuroscience 2022Quote: ... TurboRFP (1:1000, Evrogen AB233), GFP (1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-mKate (1:2500, Evrogen #AB233), anti-Cas9 (1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-KillerRed (Evrogen AB961; 1:5000), and anti-β-actin (Cell Signaling Technologies 4967 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-tagRFP (1:1000; AB233, Evrogen), anti-Por1 serum (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-TagGFP2 (Evrogen #AB121; 1:3000), anti-N1 ((Postigo & Way 2012) ...
-
bioRxiv - Microbiology 2024Quote: ... anti-RFP (1:2,000, AB233, Evrogen), rabbit anti-Src antibody (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-Aub antibody (1:20) (Patil and Kai 2010) or mouse anti-mKate2 (Evrogen, 1:200) was added to the cleared lysate and incubated at 4°C for 2 h with rotation ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-tRFP Rabbit (Evrogen, 1:250). Secondary antibodies used were goat anti-Rabbit Alexa Fluor 488 (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... rabbit polyclonal anti-tagRFP (Evrogen, 1:1000). HRP-conjugated goat anti-mouse and goat anti-rabbit IgG (H+L ...
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit anti-tRFP 1:500 (Evrogen AB233), Rabbit anti-S100 1:300 (VWR/ProteinTech 15146-1-AP) ...
-
bioRxiv - Cancer Biology 2023Quote: ... rabbit anti-RFP (Evrogen, AB234, 1:1000), chicken anti-GFP (Novus ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-TagGFP2 antibody (Evrogen #AB121; 1:3000). HRP-conjugated secondary antibodies were purchased from The Jackson Laboratory.
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-tagRFP (1:250, Evrogen AB233), chicken anti-PV (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-tagRFP (1:100, Evrogen AB233), goat anti-chicken biotin (1:200 ...
-
bioRxiv - Physiology 2023Quote: ... with 1% beta-mercaptoethanol in a 1.5-ml tube using a polypropylene pestle and a drill and then incubated (55 °C, 10 min) with protein kinase K (Evrogen, Russia). Total RNA was extracted by a silica spin column (CleanRNA Standard ...
-
bioRxiv - Biophysics 2019Quote: ... rabbit anti-tagRFP pAb (1:1000; ab233, Evrogen), mouse anti-PLB mAb (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... fRed (rabbit anti-tRFP, 1:500; AB233, Evrogen), or eGFP (chicken ...